ID: 1164080607

View in Genome Browser
Species Human (GRCh38)
Location 19:21858754-21858776
Sequence CTGGCATTGGTCACAGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164080599_1164080607 28 Left 1164080599 19:21858703-21858725 CCCTTCCTGGTAGAAACAGAGGA No data
Right 1164080607 19:21858754-21858776 CTGGCATTGGTCACAGACTGAGG No data
1164080602_1164080607 23 Left 1164080602 19:21858708-21858730 CCTGGTAGAAACAGAGGAGAGGC No data
Right 1164080607 19:21858754-21858776 CTGGCATTGGTCACAGACTGAGG No data
1164080600_1164080607 27 Left 1164080600 19:21858704-21858726 CCTTCCTGGTAGAAACAGAGGAG No data
Right 1164080607 19:21858754-21858776 CTGGCATTGGTCACAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164080607 Original CRISPR CTGGCATTGGTCACAGACTG AGG Intergenic