ID: 1164081984

View in Genome Browser
Species Human (GRCh38)
Location 19:21866793-21866815
Sequence GGACTGTACTGCTGCCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164081984_1164081993 10 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081993 19:21866826-21866848 CCGCATGAGAGGGAGACCGGAGG No data
1164081984_1164081998 23 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081998 19:21866839-21866861 AGACCGGAGGGAGAGGGAGAGGG No data
1164081984_1164081989 7 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081989 19:21866823-21866845 GCCCCGCATGAGAGGGAGACCGG No data
1164081984_1164081995 16 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081995 19:21866832-21866854 GAGAGGGAGACCGGAGGGAGAGG No data
1164081984_1164081999 24 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081999 19:21866840-21866862 GACCGGAGGGAGAGGGAGAGGGG No data
1164081984_1164081994 11 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081994 19:21866827-21866849 CGCATGAGAGGGAGACCGGAGGG No data
1164081984_1164082003 29 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164082003 19:21866845-21866867 GAGGGAGAGGGAGAGGGGGAGGG No data
1164081984_1164081996 17 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081996 19:21866833-21866855 AGAGGGAGACCGGAGGGAGAGGG No data
1164081984_1164081987 -1 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081987 19:21866815-21866837 CAGCTTCGGCCCCGCATGAGAGG No data
1164081984_1164082000 25 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164082000 19:21866841-21866863 ACCGGAGGGAGAGGGAGAGGGGG No data
1164081984_1164082002 28 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164082002 19:21866844-21866866 GGAGGGAGAGGGAGAGGGGGAGG No data
1164081984_1164082004 30 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164082004 19:21866846-21866868 AGGGAGAGGGAGAGGGGGAGGGG No data
1164081984_1164081997 22 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081997 19:21866838-21866860 GAGACCGGAGGGAGAGGGAGAGG No data
1164081984_1164081988 0 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081988 19:21866816-21866838 AGCTTCGGCCCCGCATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164081984 Original CRISPR GGACTGTACTGCTGCCATCT CGG (reversed) Intergenic