ID: 1164081989

View in Genome Browser
Species Human (GRCh38)
Location 19:21866823-21866845
Sequence GCCCCGCATGAGAGGGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164081984_1164081989 7 Left 1164081984 19:21866793-21866815 CCGAGATGGCAGCAGTACAGTCC No data
Right 1164081989 19:21866823-21866845 GCCCCGCATGAGAGGGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164081989 Original CRISPR GCCCCGCATGAGAGGGAGAC CGG Intergenic