ID: 1164083605

View in Genome Browser
Species Human (GRCh38)
Location 19:21881529-21881551
Sequence ACTTAAAGAGCAAATCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164083605_1164083606 -7 Left 1164083605 19:21881529-21881551 CCTCAAAGATTTGCTCTTTAAGT No data
Right 1164083606 19:21881545-21881567 TTTAAGTTGTGAAATATCCAAGG No data
1164083605_1164083608 11 Left 1164083605 19:21881529-21881551 CCTCAAAGATTTGCTCTTTAAGT No data
Right 1164083608 19:21881563-21881585 CAAGGTTATGTTGTCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164083605 Original CRISPR ACTTAAAGAGCAAATCTTTG AGG (reversed) Intergenic