ID: 1164087872

View in Genome Browser
Species Human (GRCh38)
Location 19:21920320-21920342
Sequence GCTCACTCCCTATCCAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164087870_1164087872 -3 Left 1164087870 19:21920300-21920322 CCACATGGTGTGACTCTGCTGCT No data
Right 1164087872 19:21920320-21920342 GCTCACTCCCTATCCAAAGGTGG No data
1164087869_1164087872 -2 Left 1164087869 19:21920299-21920321 CCCACATGGTGTGACTCTGCTGC No data
Right 1164087872 19:21920320-21920342 GCTCACTCCCTATCCAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164087872 Original CRISPR GCTCACTCCCTATCCAAAGG TGG Intergenic
No off target data available for this crispr