ID: 1164088676

View in Genome Browser
Species Human (GRCh38)
Location 19:21928377-21928399
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164088676_1164088684 23 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088684 19:21928423-21928445 ATGTGACTCTTTTTTAGGGCGGG No data
1164088676_1164088682 19 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088682 19:21928419-21928441 GATAATGTGACTCTTTTTTAGGG No data
1164088676_1164088686 28 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088686 19:21928428-21928450 ACTCTTTTTTAGGGCGGGAAGGG No data
1164088676_1164088685 27 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088685 19:21928427-21928449 GACTCTTTTTTAGGGCGGGAAGG No data
1164088676_1164088681 18 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088681 19:21928418-21928440 AGATAATGTGACTCTTTTTTAGG No data
1164088676_1164088683 22 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088683 19:21928422-21928444 AATGTGACTCTTTTTTAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164088676 Original CRISPR GTATGTATCAATGATGCCTG TGG (reversed) Intergenic