ID: 1164088678

View in Genome Browser
Species Human (GRCh38)
Location 19:21928399-21928421
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164088678_1164088685 5 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088685 19:21928427-21928449 GACTCTTTTTTAGGGCGGGAAGG No data
1164088678_1164088684 1 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088684 19:21928423-21928445 ATGTGACTCTTTTTTAGGGCGGG No data
1164088678_1164088681 -4 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088681 19:21928418-21928440 AGATAATGTGACTCTTTTTTAGG No data
1164088678_1164088687 21 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088687 19:21928443-21928465 GGGAAGGGATATGTCCACAGTGG No data
1164088678_1164088682 -3 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088682 19:21928419-21928441 GATAATGTGACTCTTTTTTAGGG No data
1164088678_1164088689 23 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088689 19:21928445-21928467 GAAGGGATATGTCCACAGTGGGG No data
1164088678_1164088683 0 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088683 19:21928422-21928444 AATGTGACTCTTTTTTAGGGCGG No data
1164088678_1164088688 22 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088688 19:21928444-21928466 GGAAGGGATATGTCCACAGTGGG No data
1164088678_1164088686 6 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088686 19:21928428-21928450 ACTCTTTTTTAGGGCGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164088678 Original CRISPR ATCTGCATTTTTGGGACCAC AGG (reversed) Intergenic