ID: 1164088682

View in Genome Browser
Species Human (GRCh38)
Location 19:21928419-21928441
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164088675_1164088682 20 Left 1164088675 19:21928376-21928398 CCCACAGGCATCATTGATACATA No data
Right 1164088682 19:21928419-21928441 GATAATGTGACTCTTTTTTAGGG No data
1164088676_1164088682 19 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088682 19:21928419-21928441 GATAATGTGACTCTTTTTTAGGG No data
1164088678_1164088682 -3 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088682 19:21928419-21928441 GATAATGTGACTCTTTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164088682 Original CRISPR GATAATGTGACTCTTTTTTA GGG Intergenic