ID: 1164088686

View in Genome Browser
Species Human (GRCh38)
Location 19:21928428-21928450
Sequence ACTCTTTTTTAGGGCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164088676_1164088686 28 Left 1164088676 19:21928377-21928399 CCACAGGCATCATTGATACATAC No data
Right 1164088686 19:21928428-21928450 ACTCTTTTTTAGGGCGGGAAGGG No data
1164088678_1164088686 6 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088686 19:21928428-21928450 ACTCTTTTTTAGGGCGGGAAGGG No data
1164088680_1164088686 -3 Left 1164088680 19:21928408-21928430 CCAAAAATGCAGATAATGTGACT No data
Right 1164088686 19:21928428-21928450 ACTCTTTTTTAGGGCGGGAAGGG No data
1164088679_1164088686 -2 Left 1164088679 19:21928407-21928429 CCCAAAAATGCAGATAATGTGAC No data
Right 1164088686 19:21928428-21928450 ACTCTTTTTTAGGGCGGGAAGGG No data
1164088675_1164088686 29 Left 1164088675 19:21928376-21928398 CCCACAGGCATCATTGATACATA No data
Right 1164088686 19:21928428-21928450 ACTCTTTTTTAGGGCGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164088686 Original CRISPR ACTCTTTTTTAGGGCGGGAA GGG Intergenic