ID: 1164088687

View in Genome Browser
Species Human (GRCh38)
Location 19:21928443-21928465
Sequence GGGAAGGGATATGTCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164088678_1164088687 21 Left 1164088678 19:21928399-21928421 CCTGTGGTCCCAAAAATGCAGAT No data
Right 1164088687 19:21928443-21928465 GGGAAGGGATATGTCCACAGTGG No data
1164088679_1164088687 13 Left 1164088679 19:21928407-21928429 CCCAAAAATGCAGATAATGTGAC No data
Right 1164088687 19:21928443-21928465 GGGAAGGGATATGTCCACAGTGG No data
1164088680_1164088687 12 Left 1164088680 19:21928408-21928430 CCAAAAATGCAGATAATGTGACT No data
Right 1164088687 19:21928443-21928465 GGGAAGGGATATGTCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164088687 Original CRISPR GGGAAGGGATATGTCCACAG TGG Intergenic