ID: 1164088751

View in Genome Browser
Species Human (GRCh38)
Location 19:21928957-21928979
Sequence CCCCTCTATAAGCAAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164088751_1164088754 -5 Left 1164088751 19:21928957-21928979 CCTGGGCCTTGCTTATAGAGGGG No data
Right 1164088754 19:21928975-21928997 AGGGGATTGAGACATTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164088751 Original CRISPR CCCCTCTATAAGCAAGGCCC AGG (reversed) Intergenic
No off target data available for this crispr