ID: 1164092845

View in Genome Browser
Species Human (GRCh38)
Location 19:21975880-21975902
Sequence AACTCTGTCCTGCCTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164092845 Original CRISPR AACTCTGTCCTGCCTAATGG GGG Intronic
903051969 1:20608068-20608090 CACTCTGTCCTGCCTTTTGCTGG - Intronic
903391430 1:22966288-22966310 GACTCTTTCCTGCCTTTTGGAGG + Intergenic
904109062 1:28110992-28111014 CACTGTGTCCTGTCTAAAGGGGG - Intergenic
906095049 1:43217223-43217245 AACAATGTCCAGCCTAATGCAGG - Intronic
906790839 1:48657494-48657516 ACCTCTGTCCTGCCTTCAGGAGG - Intronic
910195261 1:84633613-84633635 AATTCTCTCCTTCCTAAGGGTGG + Intronic
912571630 1:110628566-110628588 ATCTCTGTACTGCCTGATGGGGG + Intronic
916823914 1:168426393-168426415 AATTTTGTCTTGCATAATGGGGG + Intergenic
917268010 1:173242350-173242372 TCCTCTGTCCTGCCTAAAGAAGG - Intergenic
920081501 1:203377396-203377418 AAATCTGTTCTTCCTAAAGGAGG - Intergenic
920815773 1:209330243-209330265 AACTCTTTCCTACCTCAGGGTGG - Intergenic
1063066861 10:2618936-2618958 ATCGTTGTCCTGACTAATGGAGG + Intergenic
1064527829 10:16276818-16276840 AAATCTGTCTTAGCTAATGGTGG - Intergenic
1068666812 10:59684990-59685012 AACTCTGTCATTCCTGAAGGAGG + Intronic
1077885542 11:6384883-6384905 CACTCTGTCCTTCCTTATGGAGG - Intergenic
1082630678 11:55538344-55538366 AACAGTGTCCTGCCTAATCAGGG + Intergenic
1082739777 11:56897940-56897962 AACTCTTTCCTGCATCATTGGGG - Intergenic
1083657897 11:64238554-64238576 AACTCTGTCCTGTTTGATGATGG - Exonic
1083982523 11:66184900-66184922 TACTCTGTCCTTCCTGCTGGTGG + Intronic
1085353698 11:75816706-75816728 CACTCTGTCCTGTGTAAAGGTGG - Intronic
1085502965 11:77039587-77039609 GACTCTGGCCTGCCTCCTGGTGG + Exonic
1099425430 12:82518016-82518038 AACTCTGTGCTGCCCCATGGTGG + Intergenic
1101810671 12:108104879-108104901 AAATTTGTCATGCCTAATAGAGG - Intergenic
1104646608 12:130502082-130502104 AGCCCTGTCTTGCCTGATGGAGG + Intronic
1104738110 12:131152442-131152464 AACTCAGTCCTGCTGATTGGTGG + Intergenic
1108829191 13:54455516-54455538 AAATCTATTCTACCTAATGGTGG - Intergenic
1111856459 13:93643704-93643726 AACTCTGGCCTCCCTATAGGAGG - Intronic
1112145111 13:96690602-96690624 ATCTCTGTCCAGGCAAATGGAGG - Intronic
1112444626 13:99452919-99452941 AATTCTGTCCTGTCTGATAGAGG - Intergenic
1116685902 14:48038235-48038257 AACTCTGTGCTACCTACTAGAGG - Intergenic
1117639487 14:57783292-57783314 AACTCTCTGCTGCCTCTTGGTGG - Intronic
1127261853 15:57332215-57332237 AATGCTGTCCTGACTAATGAGGG - Intergenic
1127282004 15:57500740-57500762 AAGTCTGTCCTGGCTAAAGTCGG - Intronic
1134029996 16:10984309-10984331 AACTCTGTCCTTGTTAGTGGTGG + Intronic
1137829387 16:51529239-51529261 AACTGCTTCCTGCCTGATGGGGG - Intergenic
1140757042 16:78076871-78076893 CACTCTAGCCTGGCTAATGGAGG - Intergenic
1141264439 16:82483326-82483348 AACTCATTACTGCCAAATGGGGG - Intergenic
1142783735 17:2203294-2203316 AGCTCTGTCCTGCCCAAGAGGGG - Intronic
1143525813 17:7471805-7471827 AACTCAGTCCTGGAAAATGGTGG + Intronic
1146644658 17:34568969-34568991 ACCTCTGTGCTGCCTTCTGGTGG - Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1155369299 18:25080999-25081021 CAGTCTTTCCTTCCTAATGGAGG + Intronic
1159686704 18:71430568-71430590 CACTGTGGCCAGCCTAATGGTGG + Intergenic
1164092845 19:21975880-21975902 AACTCTGTCCTGCCTAATGGGGG + Intronic
928736570 2:34298099-34298121 ATCTCTGTCATACCAAATGGAGG + Intergenic
929889947 2:45910699-45910721 AACTATTTCCTACCTATTGGAGG + Intronic
935585473 2:104796639-104796661 GAATCAGTCCTCCCTAATGGTGG - Intergenic
935585479 2:104796662-104796684 GAATCAGTCCTCCCTAATGGTGG - Intergenic
937635864 2:124154551-124154573 CACTCTGTCCTGCCACATGATGG + Intronic
939197451 2:138990490-138990512 AAGTCTGTCTTGTCTAAGGGTGG + Intergenic
941579165 2:167273652-167273674 AACTCAGTCCTTCCAAATAGTGG + Intergenic
942133905 2:172906655-172906677 CACTCTGGCCTGCCTGGTGGAGG + Intronic
1169330886 20:4715330-4715352 AACTCTGTCCTACCAATTGCAGG - Intergenic
1170550105 20:17469164-17469186 AAGTCTGTCCTGCCAAGAGGAGG - Intronic
1170611393 20:17916534-17916556 CAATCTGGCCTGCCTGATGGAGG + Intergenic
1177117593 21:17104901-17104923 AACTCTGTCCTGTCTCAGGCAGG - Intergenic
1177824510 21:26067373-26067395 AAGTCTGTCTTGCCCAACGGTGG - Intronic
1180675870 22:17586173-17586195 ATGTATGTTCTGCCTAATGGTGG + Intronic
1180844733 22:18974912-18974934 AGCTGTGTCCTGTCCAATGGAGG + Intergenic
1182895493 22:33856004-33856026 ACCTCTGTGCTGCTTACTGGAGG + Intronic
1184763191 22:46557235-46557257 TACTCTGTGCTGCCTTATGCAGG + Intergenic
953877772 3:46676241-46676263 AACTCTGGGCTGCCTACAGGTGG - Exonic
954392383 3:50274453-50274475 AACTCTGTCCTGCCCACTGGGGG + Exonic
955106974 3:55907889-55907911 AATTCTGCCCTGCCTATTGTTGG - Intronic
959263805 3:104113419-104113441 AGCTCTGTCCTGCCTCAGGCAGG - Intergenic
967145155 3:186600154-186600176 AACTCTGTCCTGTTTAATTCAGG + Intergenic
968894422 4:3390325-3390347 AACTCTGACCTGCCACGTGGAGG - Intronic
975655317 4:76635581-76635603 AATTCTGTCCTGCCTAAATCAGG + Intronic
985550307 5:529323-529345 ACCTCTGTGCTGCCTACAGGCGG - Intergenic
987161830 5:15152737-15152759 AACTCTTCCCTGTCGAATGGAGG - Intergenic
988131729 5:27114996-27115018 AACTCTGTCTTGCATTATGTTGG + Intronic
989543163 5:42641554-42641576 AATTCTGTGGTGCCTAAGGGAGG + Intronic
989801868 5:45552537-45552559 AAGTCTGTCCTGTTTAATGAAGG - Intronic
993070564 5:83157308-83157330 TACTCTGTTCTGCCTATTGTCGG + Intronic
996764603 5:127023269-127023291 AACTCTGTCCTCCCTATATGTGG + Intronic
998477992 5:142437458-142437480 ATGCCTGTCCTGCCTCATGGTGG + Intergenic
1004513321 6:16300365-16300387 AACTTTCTCCTGTGTAATGGCGG - Exonic
1007143839 6:39606900-39606922 AACTCTATCCTGCCTGAGGTTGG + Intronic
1007289104 6:40771488-40771510 AACTATGTGCTGGCTTATGGTGG - Intergenic
1007629513 6:43265063-43265085 AACTCTGACCTGGGAAATGGAGG + Intronic
1007901737 6:45420060-45420082 TACTCTGTCCTTCCTAATTGGGG - Intronic
1011714490 6:90090648-90090670 AACTCAGTCTGGCCTAATGAGGG - Intronic
1015085982 6:129292597-129292619 AAATCTGTCCACCCTCATGGAGG - Intronic
1017499897 6:155014298-155014320 AACCCTATCCTGCATAATGAGGG - Intronic
1018163778 6:161074770-161074792 TACTGTGTCCTGCCTAAGGATGG + Intronic
1019532966 7:1512831-1512853 AACTCTCTCCTGCCTGAGGCTGG + Intergenic
1020365925 7:7380445-7380467 AACCTTGTCCTGCCTTGTGGTGG - Intronic
1020739972 7:12003357-12003379 AACTCAGTCTTGACTAAAGGGGG - Intergenic
1021993436 7:26157891-26157913 AGCTCTCTCCTGCCTTTTGGTGG + Intronic
1023532924 7:41177161-41177183 AACTCTATTCTTCCCAATGGGGG - Intergenic
1025785860 7:64642796-64642818 GCCTCAGTCCTGCTTAATGGGGG + Intergenic
1033072258 7:138214856-138214878 CACCCTGTGCTGTCTAATGGAGG + Intergenic
1033512023 7:142068592-142068614 TACTCTGTCCTGGAAAATGGTGG + Intronic
1038362159 8:26891219-26891241 AATTCTGTCCTGCCCACAGGTGG - Intergenic
1041298445 8:56386580-56386602 AATTCTGTTCTGCCTGATGCTGG - Intergenic
1042098715 8:65248800-65248822 GACTCGGCCCTTCCTAATGGAGG - Intergenic
1043070806 8:75633581-75633603 AACTCTGTTCTACCTACTGTGGG + Intergenic
1045780246 8:105854338-105854360 AACTCTGTGAAGCATAATGGTGG - Intergenic
1046275563 8:111955508-111955530 AACTCTGTCCTGTGAAGTGGTGG + Intergenic
1048872276 8:138809464-138809486 GACCTTGTCCTGCCTAAAGGAGG + Intronic
1049000925 8:139825301-139825323 CACTCTTTCCCGCCGAATGGAGG + Intronic
1050531175 9:6590823-6590845 AACTCAGTCCTGTTTAATTGAGG + Intronic
1052979223 9:34435781-34435803 AAATCAGTCCTCCCTGATGGAGG + Intronic
1060311259 9:122464551-122464573 CACTCTGTCCGACCTAGTGGGGG + Intergenic
1062027929 9:134349139-134349161 AACACTGCCCTGCCTCATGAGGG + Intronic
1062658581 9:137616560-137616582 ACCACTGCCCAGCCTAATGGTGG + Intronic
1187921931 X:24212633-24212655 AACTCTGTCTTACCTAGTGAGGG + Exonic
1189948666 X:46206008-46206030 AAATCTGTCCTGCCTATCAGTGG + Intergenic
1194790436 X:98141684-98141706 GACTCTGGCCTGCATAATAGAGG + Intergenic
1196832613 X:119787994-119788016 CTCTGTGTCCTGCCTGATGGTGG - Intronic
1201719228 Y:17078724-17078746 AAGTATGCCCTGCCTAGTGGAGG + Intergenic
1201719666 Y:17082718-17082740 AAGTGTGTCCTGCATAGTGGAGG - Intergenic
1201719781 Y:17083861-17083883 AACTGTGTCCTGCACAGTGGAGG - Intergenic