ID: 1164093941

View in Genome Browser
Species Human (GRCh38)
Location 19:21987974-21987996
Sequence CCTGTAGGGTACAGAAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164093941_1164093946 -8 Left 1164093941 19:21987974-21987996 CCGGACTTTCTGTACCCTACAGG 0: 1
1: 0
2: 3
3: 26
4: 133
Right 1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG 0: 1
1: 0
2: 7
3: 34
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164093941 Original CRISPR CCTGTAGGGTACAGAAAGTC CGG (reversed) Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904885526 1:33735392-33735414 AGTGTAGGGGAGAGAAAGTCAGG + Intronic
905927694 1:41763492-41763514 GCTGTAGGGGACATGAAGTCAGG - Intronic
908067753 1:60425876-60425898 CCTGTAGAGAACAGAAACCCAGG - Intergenic
911053406 1:93691405-93691427 CCTGTGGGGTACACACAGCCTGG + Intronic
912771000 1:112464458-112464480 CCTGGCCTGTACAGAAAGTCCGG + Intergenic
913414944 1:118594764-118594786 ACTGTAAGGTCCACAAAGTCAGG - Intergenic
916597550 1:166258555-166258577 CCTGTAGAGCACAGAAATTCAGG - Intergenic
917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG + Intronic
920835117 1:209503196-209503218 CCTGGAGAGCACAGAAACTCAGG - Intergenic
920880368 1:209874901-209874923 CATGTATGATACAGAAAGACAGG + Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
921485968 1:215715930-215715952 CCTGAAGGGTGCAGAAATTAAGG - Intronic
1062866668 10:861350-861372 TCTGTAAGCTACAGAAAATCTGG + Intronic
1065100531 10:22326185-22326207 CCTGTAGGTAGAAGAAAGTCTGG - Intronic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067292439 10:44953621-44953643 CCTGTGGGGCACAGAGAGTGTGG - Intergenic
1067304648 10:45050391-45050413 CTTGTAGGGGATAGAAAGACTGG - Intergenic
1067569285 10:47359915-47359937 CCTGGAGGGGAAAGAAAGGCAGG - Intergenic
1068571789 10:58637910-58637932 CCAGTAAGGTACAGAAGGCCTGG + Intronic
1069140850 10:64823436-64823458 CCTGTAAGGGACAGGAAGTGTGG - Intergenic
1069833222 10:71293678-71293700 CCTGTAGGGGACAGCAAGGGTGG - Exonic
1071938116 10:90553204-90553226 CCTGTGGGGTACAAATAGACTGG - Intergenic
1072529120 10:96301662-96301684 TCTGAAGGGTACAGTAAGACTGG + Intergenic
1079308414 11:19344616-19344638 CCTCTAGGTTACAGAAGGTCTGG + Intergenic
1082214905 11:49558170-49558192 GCTGGAGGGTACAGAAAGCTAGG - Intergenic
1083590622 11:63891849-63891871 CCAGCAGGGTACTGAAAGCCTGG - Intronic
1083841651 11:65308338-65308360 CCTGGAAGGCACAGAAAGTGTGG + Intergenic
1085238217 11:75031569-75031591 CCTGAATGGTACAGATAGTCGGG - Intergenic
1086634676 11:89066300-89066322 GCTGGAGGGTACAGAAAGCTAGG + Intergenic
1089321576 11:117630139-117630161 CCTGTGGGGGACAGAAGGGCAGG - Intronic
1090202142 11:124864782-124864804 CCTGTAGGAGACTGAAAGCCAGG - Intergenic
1091744823 12:2984441-2984463 CATGTAGGCGACAGAAAGACAGG + Intronic
1092038274 12:5360661-5360683 CCTGTATGGAACAGAAAGAGGGG + Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1095159140 12:38895632-38895654 CCAGTAGGGAACAGAAAAACAGG + Intronic
1095616891 12:44200880-44200902 CCTCTTGGATACAGAAAGTCTGG + Intronic
1095732192 12:45518396-45518418 CTTGTAGGATACAGATAGTTGGG - Intergenic
1096525650 12:52208537-52208559 CTTGTAGAGCACAGAAACTCAGG + Intergenic
1097930799 12:65183381-65183403 CCTGTTGGGTAGTGCAAGTCTGG + Intronic
1098701353 12:73631611-73631633 ACAATAGGGTAGAGAAAGTCTGG + Intergenic
1099368032 12:81794030-81794052 CCTGTAGGAAAGAGAAAGTTAGG - Intergenic
1102108352 12:110344983-110345005 CATGTAAGGTACAGAAAGAAAGG - Intronic
1103333033 12:120168028-120168050 CCTGTAGGGAACATAAGGTTAGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107592026 13:41919141-41919163 CCTGTAGAGCACAGAAACCCAGG + Intronic
1108955791 13:56155745-56155767 TCTGTAGAGCACAGAAACTCAGG + Intergenic
1110227541 13:73135558-73135580 CCTGTAGAGCACAGAAACTCAGG - Intergenic
1110438830 13:75505132-75505154 CCTGTCTGATACAGAAAGTGAGG - Intergenic
1110972493 13:81782559-81782581 CCTTTAGAGTAAATAAAGTCAGG + Intergenic
1116524979 14:45892711-45892733 CATGTAGGGTAGAAGAAGTCAGG + Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1120226911 14:81800853-81800875 ACTGTAGGGTACCGAAACACTGG - Intergenic
1120845682 14:89122913-89122935 GCTGTAGGTTACAGATCGTCTGG - Intergenic
1124401055 15:29347950-29347972 TCTGGAGGGCACAGAGAGTCAGG + Intronic
1126185313 15:45825433-45825455 TCTGTCTGGTACAGAAAGTGGGG - Intergenic
1128228275 15:66017842-66017864 CCTGTAGAGCACAGAAGGACTGG + Intronic
1130036140 15:80363219-80363241 CCTTTAGGGTACAGAGACCCTGG - Intronic
1130954247 15:88615670-88615692 GCTGTGGGGCCCAGAAAGTCAGG - Intergenic
1132849388 16:2017930-2017952 CCAGAAGGGCACAGAAAGGCTGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134223941 16:12377091-12377113 CCTGGAGAACACAGAAAGTCTGG - Intronic
1134627286 16:15731272-15731294 CCTGTAGAGGCCAGAAAGTGGGG + Intronic
1135548227 16:23379749-23379771 CCTGTAGGGAACTGGTAGTCAGG + Intronic
1139474056 16:67193699-67193721 CCAAAAGGGTACAGAAATTCTGG + Intronic
1139511948 16:67432620-67432642 TCTGTAGGGGACAGCCAGTCTGG + Intronic
1141950208 16:87335008-87335030 CCTGTGGGGTTTAGGAAGTCTGG - Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1151766359 17:76135357-76135379 CCTGCAGGGTCCAGGAAGGCAGG - Intergenic
1153409846 18:4781516-4781538 CCTGTAGAGCACAGAAATGCAGG + Intergenic
1154157029 18:11951787-11951809 CCTGCAGGGCACAGAGAGTCTGG - Intergenic
1155646220 18:28081099-28081121 CCTGTGGTGTACAGGAAGTCAGG - Intronic
1156173523 18:34515131-34515153 ACGTTAGGGTAGAGAAAGTCAGG - Intronic
1159227701 18:65561565-65561587 CCTAGAGGGTGCAGAAATTCAGG + Intergenic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1164467738 19:28502152-28502174 GCTGCAGGGTACAGGAAGTGGGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166626974 19:44366694-44366716 CCTGTAGGGATCAGAAAGAAGGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
928862964 2:35881995-35882017 TCTGTAGGGTAAAGAAAGGAAGG - Intergenic
937983364 2:127627649-127627671 CCTGGAGGGTACAGGTTGTCTGG + Intronic
938307871 2:130267031-130267053 CCTGTGGGGTATAGAGAGTGTGG - Intergenic
938447465 2:131389810-131389832 CCTGTGGGGTATAGAGAGTGTGG + Intergenic
940023609 2:149181651-149181673 CATGGAGGATTCAGAAAGTCAGG - Intronic
942972037 2:181968604-181968626 CCTGTAGGGAACAGATAATTGGG + Intronic
944446598 2:199798089-199798111 CTTCTAGGGAACAGAAAGTCTGG - Intronic
945795799 2:214362050-214362072 CCTGTAGGTTACTGAAATTTGGG - Intronic
948469439 2:238167683-238167705 CCTTTGGGGGACAGTAAGTCTGG + Intronic
1169641896 20:7761471-7761493 CCTGCTAGGTACAGAGAGTCTGG - Intergenic
1170262453 20:14425328-14425350 GCTGGAGGGTGGAGAAAGTCTGG - Intronic
1171413976 20:24965204-24965226 CTTGTAGGGCACAGAGAGACTGG - Intronic
1179439034 21:41380438-41380460 CCTGTGGAGTAGAGAAAGCCTGG - Intronic
1182567354 22:31210330-31210352 TCTGGAGGGTAGAGAAAGCCTGG - Intergenic
1183069274 22:35384972-35384994 CCTTGAGGGGACAGAAAGCCAGG - Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1184592113 22:45491765-45491787 CCTGTAGTGGAAAGAAAGCCGGG + Intergenic
952342578 3:32458210-32458232 CCAGTGGGGCACAGAAACTCAGG - Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
956687608 3:71844706-71844728 CCTGTTGGGGACAGAAAATGAGG - Intergenic
959370871 3:105523499-105523521 CTTGTAGGGTACATAAAGGAGGG + Intronic
961094271 3:124141196-124141218 CCTGCAGGGTTCAGAAAGCCAGG - Intronic
961143524 3:124575250-124575272 CCTCTAGGCCACAGGAAGTCTGG + Intronic
963068062 3:141279551-141279573 CCTGTAGGATAGAGAATGACAGG + Intronic
963437565 3:145290052-145290074 CCTGTAGGCCACAGAAACCCAGG - Intergenic
966097585 3:176222980-176223002 CTTGTAGAGCACAGAAACTCAGG + Intergenic
967275339 3:187768689-187768711 CCTGGAGTGTTCAGAAAGGCTGG + Intergenic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
970432617 4:16002616-16002638 CTTGTAGGTCAGAGAAAGTCAGG - Intronic
976933572 4:90599666-90599688 CCTGTGGAGCACAGAAACTCAGG - Intronic
978399623 4:108316803-108316825 CCTGGTGGGAACAGAAAGGCAGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
982770696 4:159394637-159394659 CCTGTAAGGCACAGAATGACAGG - Intergenic
984500551 4:180553352-180553374 CCTTTAGGGTACAGAAAAATTGG - Intergenic
985630325 5:1010600-1010622 GCTGTAAGGTACAGTAAGTTGGG + Intronic
986977289 5:13409402-13409424 CCTGTGGAGCACAGAAACTCAGG + Intergenic
989009585 5:36855215-36855237 CCTCCGGGGTACAGAAGGTCAGG + Intergenic
990743229 5:58933510-58933532 TCTGCAGGAAACAGAAAGTCAGG + Intergenic
992549956 5:77850822-77850844 CCTTTAAGGGACAGATAGTCTGG - Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
999343076 5:150790224-150790246 CCTGTAAGATACAGGAACTCAGG - Intronic
1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG + Intergenic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006112101 6:31753686-31753708 TGTCTAGGGTACAGACAGTCTGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1008024092 6:46614453-46614475 TCTGTAGGAAGCAGAAAGTCAGG - Intronic
1019505021 7:1386388-1386410 CCTGTGGGGAGCAGACAGTCGGG - Intergenic
1023660199 7:42463073-42463095 CCTGTAAGGTACTGAAAGCTAGG + Intergenic
1030174286 7:106634872-106634894 GCTGTGTGGTACAGCAAGTCAGG + Intergenic
1030745102 7:113155775-113155797 CCAATAGGGTCCAGAAAGCCAGG - Intergenic
1031335615 7:120527398-120527420 GATGTAGTGTACCGAAAGTCAGG - Intronic
1031643062 7:124189664-124189686 CCTGTGGGGTACAAAAGGCCAGG - Intergenic
1035314882 7:157991517-157991539 CGTGCAGGGCACAGAAACTCAGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1038465256 8:27756398-27756420 ACTGGAGGAGACAGAAAGTCTGG + Intronic
1039075778 8:33689468-33689490 AGTGTTGGGTACAGAAGGTCTGG + Intergenic
1043935447 8:86137231-86137253 TCTGTAGGGTACAGCAACTAAGG - Intronic
1048190627 8:132285262-132285284 CGAGAAGGTTACAGAAAGTCTGG + Intronic
1049775419 8:144401673-144401695 CCTGGAGGGGAGAGAAAGACAGG + Exonic
1049965500 9:775796-775818 CCTGCAGGGCACAGAAGCTCAGG + Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1055859589 9:80731500-80731522 CCTGTAGAATACAGAAACCCAGG - Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057570308 9:96199112-96199134 CCTGTAAGGAACAGACAGACAGG - Intergenic
1058351750 9:104033523-104033545 TCTGTAGGATACAGAATTTCAGG + Intergenic
1059640807 9:116214775-116214797 CCTGTAGGCTAGAGAAAGCCTGG - Intronic
1059844764 9:118262539-118262561 CCTGTAGAGCACAGAGACTCAGG - Intergenic
1062125882 9:134862413-134862435 GCAGTAGGGAACAGAAAGACTGG - Intergenic
1062713258 9:137988214-137988236 CCCGTAGGGTCCTGAATGTCAGG + Intronic
1186785369 X:12952017-12952039 CCTTGAGGTTACAGAAAGACTGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1190776013 X:53552783-53552805 CCTCTAAGGTACAGGAAGCCAGG + Exonic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic