ID: 1164093946

View in Genome Browser
Species Human (GRCh38)
Location 19:21987989-21988011
Sequence CCTACAGGTGGTATTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164093937_1164093946 20 Left 1164093937 19:21987946-21987968 CCTGTCTCTTCTCATTCCTTCGT 0: 6
1: 30
2: 16
3: 41
4: 577
Right 1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG 0: 1
1: 0
2: 7
3: 34
4: 114
1164093939_1164093946 4 Left 1164093939 19:21987962-21987984 CCTTCGTCGCCACCGGACTTTCT 0: 1
1: 0
2: 2
3: 9
4: 59
Right 1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG 0: 1
1: 0
2: 7
3: 34
4: 114
1164093940_1164093946 -5 Left 1164093940 19:21987971-21987993 CCACCGGACTTTCTGTACCCTAC 0: 1
1: 0
2: 11
3: 17
4: 72
Right 1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG 0: 1
1: 0
2: 7
3: 34
4: 114
1164093941_1164093946 -8 Left 1164093941 19:21987974-21987996 CCGGACTTTCTGTACCCTACAGG 0: 1
1: 0
2: 3
3: 26
4: 133
Right 1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG 0: 1
1: 0
2: 7
3: 34
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164093946 Original CRISPR CCTACAGGTGGTATTGAAGC TGG Intronic
900908230 1:5575806-5575828 CCCACAGGCGTTTTTGAAGCTGG - Intergenic
901517371 1:9757673-9757695 CCTACAGTTAGTTTTGAATCTGG - Intronic
901687360 1:10950402-10950424 CCATCTGGTGGCATTGAAGCTGG - Intronic
902341047 1:15783893-15783915 TCTAAAGGGGTTATTGAAGCCGG + Intronic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
905804604 1:40866804-40866826 CCTTCAGGAGGTATTGCAGAAGG + Intergenic
906029441 1:42706171-42706193 CCTTCAGGAGGTATTCCAGCAGG - Intergenic
912231467 1:107797821-107797843 CCTCCAGGTGGTATTGGTGCAGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
921551742 1:216545157-216545179 CCTACTGGTGAAACTGAAGCAGG - Intronic
921908883 1:220527284-220527306 CCTACAGGATGTCTTGAGGCAGG + Intergenic
921965360 1:221082506-221082528 CCTACAAGTGCTATTGTAGGTGG + Intergenic
922977397 1:229796966-229796988 CCTAAAGGTGGAAATGAAGGTGG + Intergenic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1067549735 10:47225971-47225993 CCTACATGTGGTATCTAAGGAGG - Intergenic
1069418598 10:68225226-68225248 CCTTCAGGTGGTATTCAAGAAGG + Intergenic
1073009760 10:100349948-100349970 CCTACAGGGGGTGCTGAGGCTGG - Intronic
1073587759 10:104726914-104726936 ACTAGAGATGGTATTGGAGCAGG - Intronic
1077184386 11:1229780-1229802 GCTGCAGGTGGTGTTGAAGGAGG - Exonic
1079016583 11:16874032-16874054 CCTCCAGGTGGAAATGAGGCAGG - Intronic
1081386075 11:42475151-42475173 CTTTCAGGTGGAATTGAAGTTGG - Intergenic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1087221524 11:95551410-95551432 CCTAAAGGGAGTTTTGAAGCTGG + Intergenic
1088298233 11:108324938-108324960 ACTACAGGCAGTATTGAAGCAGG + Intronic
1090707840 11:129355543-129355565 TCTACAGGAAGGATTGAAGCAGG + Intergenic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1100069446 12:90694360-90694382 AATACAGGTGGTATTTAAACAGG - Intergenic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1106505050 13:30363932-30363954 CATAGAGGTGCTATTGAGGCTGG - Intergenic
1107097655 13:36553589-36553611 CCTACAAGTGGATTTGAAGCTGG + Intergenic
1112719094 13:102222482-102222504 ACTACTGGAGGTATTTAAGCTGG - Intronic
1115853831 14:37608851-37608873 ACTACAGGGGGCTTTGAAGCTGG + Intronic
1119374231 14:74176125-74176147 CCTACAGGAGGTATTCTAGAAGG - Intronic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1121290732 14:92772918-92772940 CATACAGTAGGTATTGGAGCTGG + Intergenic
1123540924 15:21290122-21290144 CCCACAGTAGGTATTGAAACTGG - Intergenic
1124138825 15:27059289-27059311 GCTACAGGTGGTTTGGAAGCGGG + Intronic
1124467323 15:29950241-29950263 CATAGAGGTGGTAGTGAAGGAGG - Intronic
1126943580 15:53792466-53792488 AATACAGGTGGAATTGAAACGGG + Intergenic
1130162070 15:81411573-81411595 CCTACAGTTATTGTTGAAGCAGG + Intergenic
1202949237 15_KI270727v1_random:17262-17284 CCCACAGTAGGTATTGAAACTGG - Intergenic
1133728120 16:8556008-8556030 CCGACAGGTGGTGTTGAAGGAGG - Intergenic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1135170524 16:20179393-20179415 CCCACAGGTAGTATTGGATCTGG + Intergenic
1137625208 16:49903419-49903441 CCTACAGGTGGTGCAGAAGCTGG - Intergenic
1140797639 16:78454837-78454859 GCAACAGTTGGTATTGAAACTGG - Intronic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1152232908 17:79123797-79123819 CCTTCAGGGGCTATTGATGCAGG + Intronic
1156946449 18:42838865-42838887 GCTACATATGGTATTGAAACTGG + Intronic
1159867268 18:73720967-73720989 CTCACTGGTGGTATGGAAGCTGG - Intergenic
1161743303 19:6038947-6038969 CCTACAAGTGGAATTGCTGCTGG - Intronic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG + Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166678821 19:44755316-44755338 CCCACAGGGAATATTGAAGCTGG + Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
925022688 2:584136-584158 CCTACAGCCGGTCTTGAAACTGG + Intergenic
926961133 2:18359577-18359599 TCTGCAGGTAGTATTGAATCTGG - Intronic
927520701 2:23696326-23696348 CCTCCAGGTGGGATGGAATCAGG + Exonic
931095800 2:58939379-58939401 CCTACAGGAGGCATAAAAGCTGG - Intergenic
931284648 2:60821665-60821687 CCAAAAGGTGATATTGAGGCTGG - Intergenic
933008084 2:77021987-77022009 CATACAGGTGGTCTTGGAGGTGG - Intronic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
933969919 2:87462038-87462060 CCTACAGGTTGAATTTCAGCTGG - Intergenic
936323862 2:111488458-111488480 CCTACAGGTTGAATTTCAGCTGG + Intergenic
944167879 2:196742682-196742704 CCTACAGGTGCAGTTCAAGCTGG - Intronic
945191160 2:207188970-207188992 CCTTCAGGTGGGATTGAATCGGG + Intergenic
945689827 2:213019757-213019779 TTTACAGGTGGTGCTGAAGCTGG - Intronic
948555965 2:238811214-238811236 TCCAAAGGTGGAATTGAAGCAGG - Intergenic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
1171010187 20:21505421-21505443 CCGACAGCTGGTTTTGAAGCGGG + Intergenic
1172200205 20:33120595-33120617 TCTCCAGTTGGTAGTGAAGCAGG + Intergenic
1172807938 20:37626353-37626375 CCTATAGATGGTTCTGAAGCTGG + Intergenic
1178447444 21:32658858-32658880 CAAACAAGTGGTATTGAAGCAGG - Intronic
1178785661 21:35650887-35650909 CCTGCAGGTGATTTTAAAGCAGG - Intronic
1180214107 21:46313936-46313958 CCCAGAGGTGGGATGGAAGCTGG - Intronic
1183018020 22:35006041-35006063 CTTAGAGGTGGGATTGGAGCTGG + Intergenic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1184994256 22:48193273-48193295 CCTGCAGGTGATATTGAATTCGG + Intergenic
952095372 3:29945240-29945262 CCTGCTGGTGGTTTTCAAGCAGG + Intronic
956221093 3:66904164-66904186 CCTACATGGGGTACTGAAACAGG + Intergenic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
961402797 3:126658813-126658835 CATCCAGGTGGTTTTGGAGCTGG - Intergenic
963831831 3:150016752-150016774 CCCAAAGATGGTATTCAAGCTGG + Intronic
967851251 3:194084150-194084172 CATACAGGTGGTGTTGATTCAGG + Intergenic
968128791 3:196179980-196180002 CCTCCAGGTGGAGTTGGAGCTGG - Intergenic
968209029 3:196831923-196831945 CCCACAGTAGGTATTGAAACTGG + Exonic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969892013 4:10268694-10268716 CTTACAGGTGGGATGGAAGGTGG + Intergenic
978400052 4:108321760-108321782 CCTACAGGGGGTTCTGAAGCTGG - Intergenic
979950782 4:126891070-126891092 CCTGCAGGAGTAATTGAAGCAGG - Intergenic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
983094196 4:163542657-163542679 CCTACAGGTGATTCTGATGCTGG - Intronic
986291752 5:6405505-6405527 AATACAGGTGGTTTTGTAGCAGG + Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
992615826 5:78545184-78545206 CCTGCAGATCGTATTGGAGCTGG - Intronic
997171916 5:131730781-131730803 CCTAGAGCTTGCATTGAAGCTGG - Intronic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
998474337 5:142407959-142407981 CCTCCAGGTGGGACTGAATCTGG + Intergenic
1001014621 5:168128883-168128905 CTGACAGGTGGCATGGAAGCTGG - Intronic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1007188438 6:39993162-39993184 CCTGGATGTGGTATTGTAGCGGG + Intergenic
1007381832 6:41495178-41495200 CCTTCAGGTTGTTTTCAAGCGGG - Intergenic
1009769722 6:68129711-68129733 GCTACAAGTAGTATTGAAGGTGG + Intergenic
1013234595 6:108186215-108186237 TCTGCAGGTGGTCATGAAGCTGG + Intronic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1014803674 6:125805796-125805818 TCTTCAGGTGGTATTGAAAATGG + Intronic
1015003967 6:128255785-128255807 CCTGCAGGTGATACTGATGCAGG + Intronic
1015062675 6:128985958-128985980 CCTACAGGTAGAATTCAAACAGG + Intronic
1022551011 7:31238654-31238676 CCAACAGGTGGTATAGAACCTGG - Intergenic
1022591886 7:31671444-31671466 GAAACAGGTGGTAATGAAGCAGG - Intergenic
1023210490 7:37798781-37798803 CCTCCAGGTGATTTTGATGCAGG + Intronic
1027210181 7:76140834-76140856 ACTACTGATGGTTTTGAAGCTGG + Intergenic
1029996178 7:105010676-105010698 CCTACCTGTGGCACTGAAGCTGG + Intergenic
1034447150 7:151119624-151119646 CCTGCAGGTGGTCTGGAAGGAGG - Intronic
1035755520 8:2028241-2028263 TCTACAGGTGGAATTGAAAACGG - Intergenic
1037422863 8:18722565-18722587 CCTTCAGGTGGAAATGAAGGGGG - Intronic
1038743681 8:30237394-30237416 CCTACAGTTGGTATTGATCTTGG + Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1042690576 8:71493572-71493594 TTTACAGGTGGTATTGAATAAGG - Intronic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1043874071 8:85464566-85464588 GCCACAGGTGGTGCTGAAGCTGG - Intronic
1045279373 8:100736334-100736356 CCTACTTGGGGGATTGAAGCAGG + Intergenic
1045852915 8:106724647-106724669 ACTCCAGGTGATATTGATGCCGG + Intronic
1046726303 8:117678333-117678355 TTTACAGTTGGTATTGAAACTGG - Intergenic
1048795010 8:138141620-138141642 CCCCCAGGTGGAATTAAAGCAGG - Intronic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1054732211 9:68712964-68712986 CATAAAGGTGGTATTTGAGCTGG + Intronic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1188231899 X:27674436-27674458 CCTAAAGGTTGAATAGAAGCTGG + Intronic
1190115226 X:47621940-47621962 CCTGGAGGTGGGACTGAAGCTGG - Intergenic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1195296478 X:103483108-103483130 CCTTCAGGAGGTATTCAAGAAGG - Intergenic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1199514522 X:148661025-148661047 CCTACAGGGGGTGGTGTAGCTGG + Intronic
1201346827 Y:12993881-12993903 CCTACATGTGATGTTGAGGCTGG - Intergenic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic