ID: 1164094036

View in Genome Browser
Species Human (GRCh38)
Location 19:21988928-21988950
Sequence CATATTTATCAACTGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164094033_1164094036 -4 Left 1164094033 19:21988909-21988931 CCTGGAAAACACAAACACACATA 0: 1
1: 1
2: 38
3: 260
4: 1763
Right 1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 186
1164094032_1164094036 -3 Left 1164094032 19:21988908-21988930 CCCTGGAAAACACAAACACACAT 0: 1
1: 0
2: 18
3: 138
4: 981
Right 1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 186
1164094029_1164094036 14 Left 1164094029 19:21988891-21988913 CCCTAAATGTCAATGATCCCTGG 0: 1
1: 1
2: 9
3: 25
4: 153
Right 1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 186
1164094028_1164094036 20 Left 1164094028 19:21988885-21988907 CCACATCCCTAAATGTCAATGAT 0: 1
1: 4
2: 16
3: 42
4: 217
Right 1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 186
1164094031_1164094036 13 Left 1164094031 19:21988892-21988914 CCTAAATGTCAATGATCCCTGGA 0: 1
1: 2
2: 5
3: 32
4: 184
Right 1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164094036 Original CRISPR CATATTTATCAACTGGACAT GGG Intronic
900729353 1:4243657-4243679 AATCTTTATCAACTCGTCATAGG - Intergenic
904186669 1:28710441-28710463 CATATTTATAAACAGCACAATGG + Intronic
908590376 1:65625797-65625819 CATATTCACAAACTGGAAATAGG + Intronic
909211861 1:72834278-72834300 AATATCCATCAACTGGATATTGG - Intergenic
909520057 1:76557597-76557619 CATATTTATTACCTGAAAATTGG - Intronic
911336529 1:96587732-96587754 AATAATAATCAACTGGTCATTGG + Intergenic
912326562 1:108768980-108769002 CAAATTTTTCAACTGCACAGGGG - Intronic
912826675 1:112910532-112910554 CAGATTGATAAACTGGATATTGG - Intergenic
919036303 1:192313294-192313316 CATATTTATCAAATGCTCATGGG - Intergenic
920421988 1:205841132-205841154 CAGATTTTACAACTGGACCTGGG - Intronic
921571278 1:216781849-216781871 CATATTTATGTACTGCACAGTGG + Intronic
923534299 1:234837124-234837146 CATATTAATGAACTGCAGATGGG - Intergenic
924785989 1:247200211-247200233 CATACGTATCAAGTGGTCATGGG + Intergenic
1063163237 10:3435729-3435751 AATATTCATCAACTGGTGATGGG + Intergenic
1065271843 10:24041080-24041102 CACATTTATCAACTGTAAATGGG + Intronic
1068536987 10:58251425-58251447 CATTTTTTTCAACAGCACATGGG - Intronic
1068548718 10:58382866-58382888 CATTTTTCTCATCTGGAAATTGG + Intergenic
1069377466 10:67808098-67808120 CATATTTCTCAACTCCACAAGGG + Intronic
1070942868 10:80362024-80362046 CATATCTATCTTATGGACATAGG - Intronic
1073443612 10:103567817-103567839 CATATTTGTCACCTGTAAATTGG + Intronic
1074190821 10:111135070-111135092 CATTTTTCTCATCTGCACATGGG - Intergenic
1074234462 10:111571330-111571352 CATGTTTATAAAAAGGACATTGG + Intergenic
1074407971 10:113196601-113196623 CATATTTCTCAGCAGCACATGGG - Intergenic
1074418073 10:113284742-113284764 CATCTGTATCAGGTGGACATTGG - Intergenic
1074499136 10:114006813-114006835 CATGTTTATCAACTGGTGAGTGG + Intergenic
1078172892 11:8942900-8942922 AGTATTTATCAACTGTACCTAGG + Intergenic
1080971831 11:37286820-37286842 CATATTTATCACCAGGAGACTGG - Intergenic
1086565158 11:88217860-88217882 CATATTTCTTCACTAGACATAGG + Intergenic
1087560368 11:99782736-99782758 CCTATTTAATAAATGGACATGGG + Intronic
1087772949 11:102230358-102230380 CATGTTTTTCCACTGGACAAAGG - Exonic
1089041992 11:115460805-115460827 CACTTATATCAACTGGACACTGG + Intronic
1090045726 11:123331245-123331267 CATAATTTTCAGCTGGTCATTGG + Intergenic
1090539868 11:127689514-127689536 CATATTTGCAAACTGTACATCGG - Intergenic
1090656174 11:128847452-128847474 CATATGTACCAATTGCACATAGG - Intronic
1091065913 11:132512095-132512117 CATATTTTTCACATGGTCATTGG - Intronic
1098570760 12:71985021-71985043 ACTATATATCAACTGGACACAGG + Intronic
1099331303 12:81292119-81292141 CATATTTTTCATCTGGAAGTTGG + Intronic
1100383982 12:94088616-94088638 CATATGTATCCACTGGACTCAGG + Intergenic
1105579444 13:21680551-21680573 CATGTTTATAAAGTGGAAATAGG + Intronic
1105943082 13:25168970-25168992 CATATCTAACAACTGAACGTAGG + Intronic
1106364815 13:29068234-29068256 CATATTATTGAAATGGACATTGG + Intronic
1108110144 13:47062670-47062692 CAGATTTCTCAACAGAACATTGG - Intergenic
1108544195 13:51474759-51474781 CATATTAATTAACTGGATAATGG - Intergenic
1108618192 13:52156477-52156499 GATATTTATTACCTGTACATAGG - Intronic
1108796238 13:54033747-54033769 AATATTTATCAACAAGACAATGG - Intergenic
1110113546 13:71781984-71782006 CCAATTTCTCAACTAGACATTGG + Intronic
1110474960 13:75902994-75903016 CATATTTACTAACTGCCCATAGG - Intergenic
1116522262 14:45864292-45864314 TATATTTATCCAATGGACAATGG + Intergenic
1118565721 14:67138753-67138775 CATAGTTTTCATCTGAACATGGG + Intronic
1119597340 14:75947506-75947528 CATATTTATGAAAAGTACATTGG + Intronic
1125129196 15:36261334-36261356 CATTTTGATCAACAGCACATAGG + Intergenic
1125635259 15:41182647-41182669 CAGATTTATAAACTGGACTCTGG + Intergenic
1126127003 15:45303860-45303882 CATATTCATCTATTGGAAATTGG - Intergenic
1127292209 15:57580890-57580912 CAAATGTCTCAAATGGACATCGG - Intergenic
1130773496 15:86949850-86949872 CATATTTTTTCATTGGACATAGG + Intronic
1130788101 15:87122651-87122673 CATATTTATCAACTGACTCTTGG + Intergenic
1134428152 16:14173005-14173027 GATTTTTATGACCTGGACATAGG - Intronic
1141623041 16:85247313-85247335 CATAATTGTCCATTGGACATTGG + Intergenic
1143692046 17:8576754-8576776 CACAGTTCTCAACTGCACATTGG - Intronic
1143898509 17:10155827-10155849 CAGATTTCTCATCTGGAAATAGG - Intronic
1144169069 17:12641172-12641194 CATATTTAGACATTGGACATGGG + Intergenic
1144283259 17:13747958-13747980 CATCTTTTTCAAGTGGACACAGG - Intergenic
1145045824 17:19614924-19614946 TATTTTTATCAACTGAACTTAGG + Intergenic
1150902398 17:69295619-69295641 CATTTCTCTCAACTGGGCATTGG + Intronic
1152274311 17:79346261-79346283 CATATTTTGAAAATGGACATAGG - Intronic
1158441570 18:57479361-57479383 TATATAGATCAACTTGACATTGG + Exonic
1158510771 18:58088674-58088696 AATATTTACAAAATGGACATTGG - Intronic
1158943361 18:62426642-62426664 CATTTTCATCAACTGTAAATTGG + Intergenic
1159338702 18:67105297-67105319 CACAGTTATCAACTGCAAATTGG + Intergenic
1163901436 19:20104190-20104212 CATTTTTACCAAGTGGTCATGGG - Intronic
1163903762 19:20132608-20132630 CATTTTTACCAAGTGGCCATAGG + Intergenic
1163940574 19:20489473-20489495 CATTTTTACCAAGTGGCCATGGG - Intergenic
1163956418 19:20646426-20646448 CATTTTTACCAAGTGGCCATGGG + Intronic
1164000928 19:21098134-21098156 TATATTTACCAAGTGGCCATGGG - Intronic
1164007703 19:21166284-21166306 TATATTTACCAAGTGGCCATGGG - Intronic
1164068673 19:21745096-21745118 TATATTTACCAAGTGGCCATGGG + Intronic
1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG + Intronic
1164113835 19:22196749-22196771 TATATTTACCAATTGGTCATGGG + Exonic
1164197932 19:22988474-22988496 CATATTTACCAAGTGGTCATGGG + Intronic
1164224674 19:23232312-23232334 CATATTTACGAAGTGGCCATGGG + Intronic
1164236627 19:23342917-23342939 CATATTTAGCAAATGGCCATGGG + Intronic
1164251461 19:23480493-23480515 CATACTTAGCAAGTGGTCATAGG + Intergenic
1164288324 19:23842506-23842528 CATATTTAGCAAGTGGTCATGGG - Intergenic
1164320571 19:24140972-24140994 CATATTTAGAAAGTGGCCATAGG - Intergenic
926597249 2:14804685-14804707 GATATTTATCTACTTTACATCGG - Intergenic
928950677 2:36810556-36810578 CATATTTGTCTACAGGGCATTGG - Intronic
929181228 2:39041813-39041835 CATATTTATGACTTTGACATAGG - Intronic
932184860 2:69685812-69685834 AATATTTAACAACTGGCCCTGGG + Intronic
933466252 2:82656398-82656420 CATTTTTATCAACAAGAAATAGG + Intergenic
933485097 2:82911260-82911282 TATATTTATCAAGTAGACATAGG + Intergenic
935806715 2:106756097-106756119 CATATTTGTCTACTGGATAATGG - Intergenic
938120620 2:128630823-128630845 CATTTTTATCACCTGGAAAATGG + Intergenic
938559472 2:132458813-132458835 CATCTTTATTGACTGGACAGAGG - Intronic
938932805 2:136101421-136101443 CACATTTATAAACTGAGCATAGG - Intergenic
939360788 2:141169920-141169942 CATATTTACAAACTGTATATTGG - Intronic
940268664 2:151867618-151867640 CACATTCATCTACTGGACAAAGG - Intronic
940832051 2:158477626-158477648 CATATTGATCAACTGGGATTAGG + Intronic
943636389 2:190311642-190311664 CATATTTATCAATCAGACTTTGG - Intronic
943693922 2:190902360-190902382 CCTATTTCTCAACTTAACATTGG + Intronic
944862717 2:203830016-203830038 CACATTTATCAGCCTGACATTGG - Intergenic
946197053 2:218039792-218039814 CATTTAAATCAACTGGTCATTGG + Intronic
947082480 2:226413834-226413856 CATTTTTCTCATCTGGAAATGGG + Intergenic
1170308694 20:14969149-14969171 TATATATATAAACTGGAGATAGG - Intronic
1170640430 20:18147315-18147337 CATTTTTCTCAAGTGTACATGGG + Intronic
1170963992 20:21050321-21050343 CATTTTTATCCACTAGATATAGG + Intergenic
1182454895 22:30444008-30444030 CATGTTTATCATCTGGGCAGGGG - Intergenic
1185316134 22:50179883-50179905 CATATTTATCATCAGGAGACAGG + Exonic
949275177 3:2270842-2270864 CATACTAAACAACTGCACATCGG - Intronic
949348809 3:3102848-3102870 CACAATGTTCAACTGGACATAGG + Intronic
949928829 3:9062114-9062136 CATAGTTGTCCACTGGAAATAGG - Intronic
951085058 3:18502601-18502623 CAGACTTATGAACTGGACAGGGG - Intergenic
953768652 3:45762535-45762557 CTAAGTTATCAACTGGACTTTGG + Intronic
954423741 3:50432432-50432454 CACATTTGTAAACTGGACAGGGG + Intronic
955437794 3:58921669-58921691 CATAATTTTCAAGTGCACATTGG - Intronic
955880905 3:63544264-63544286 CGTATTTATCAGCTGGGGATAGG - Intronic
956476674 3:69628712-69628734 CATATTCAGCAACTAGACAATGG + Intergenic
956829735 3:73034460-73034482 CATAGTTATCAAATGGAGCTAGG - Intronic
957337968 3:78857262-78857284 CATTTTTATCTATTAGACATGGG + Intronic
958867791 3:99521509-99521531 CATATTTAGTAATTGGAAATGGG - Intergenic
959287232 3:104430561-104430583 CTTCTTTTTCAACAGGACATTGG - Intergenic
959545281 3:107588633-107588655 TATATTTTTAAACTGGAAATGGG - Intronic
960738238 3:120803984-120804006 AATAATTTTCCACTGGACATGGG + Intergenic
961031723 3:123611131-123611153 AATATTTATTAACTGGACAATGG + Intronic
962237693 3:133721526-133721548 CATTCTTCTCAACTGCACATGGG - Intergenic
963680843 3:148374418-148374440 CATATTTATTAACTATAAATGGG + Intergenic
965689031 3:171335660-171335682 CATACTTATCAAATGGAAAATGG - Intronic
966528483 3:180946107-180946129 CATAATTATCAACTGGTCAACGG + Intronic
967660166 3:192097615-192097637 AATATTTGCCAACTGTACATCGG + Intergenic
970081772 4:12295302-12295324 ATTATGTATTAACTGGACATTGG - Intergenic
971516160 4:27489521-27489543 CACATTTTTCAAATGTACATGGG + Intergenic
977253743 4:94717260-94717282 TATTTTTATTAAGTGGACATTGG + Intergenic
977365072 4:96057114-96057136 CATATTAATAAACTGAACTTTGG + Intergenic
978668512 4:111216235-111216257 CACATTTAACTCCTGGACATGGG + Intergenic
979647564 4:123089460-123089482 CATATTTATCAATTCCAAATAGG + Intronic
979792840 4:124807618-124807640 CATATTTTTCATATGTACATGGG + Intergenic
981514273 4:145589896-145589918 CATATTTATAAAATGCACAATGG - Intergenic
984018615 4:174456564-174456586 CATAATTATCAACTGGCCACGGG + Intergenic
985220258 4:187696719-187696741 AATATTTATCACCAGGACAACGG + Intergenic
985728872 5:1533536-1533558 AATATTTATCAACAGGAGAATGG - Intergenic
989701264 5:44267710-44267732 AATATAAATCAACTAGACATGGG - Intergenic
990292863 5:54371969-54371991 CATTTTTCTCAAGTGCACATGGG - Intergenic
990772478 5:59264673-59264695 TATAATTAACAACTGCACATTGG - Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991257715 5:64633373-64633395 AATATCCATCAACTGGACAATGG - Intergenic
991317646 5:65327395-65327417 CATGGTGATAAACTGGACATGGG + Intronic
992152696 5:73921349-73921371 CTTATTTATCATCTGGTCAAAGG - Intronic
992286312 5:75238806-75238828 CATATATATCAATTAGACAATGG - Intergenic
992653365 5:78883948-78883970 TATATTTTGCAACTGGAAATTGG + Intronic
993493453 5:88580698-88580720 CCTATTTATCAACTGTATACTGG - Intergenic
994849737 5:105038883-105038905 AATTTTTATCAACAGGAAATTGG - Intergenic
994991672 5:107004615-107004637 CATATCTATTAAGAGGACATTGG + Intergenic
995174778 5:109163279-109163301 CCTGTTTATCAACTGGAGATTGG - Intronic
995634996 5:114177856-114177878 CATTTTGATCAATTAGACATCGG + Intergenic
995773082 5:115693328-115693350 CATTTTTCTCAATTGCACATGGG - Intergenic
996883716 5:128330854-128330876 CACATTTATAGCCTGGACATTGG - Intronic
998497296 5:142601844-142601866 AATAATTATCAAATGGACATTGG - Intronic
999044819 5:148455669-148455691 CAGATTTTTCAACTGCACAGGGG - Intronic
1000850004 5:166328523-166328545 AATATTTATCAACAGGAGAATGG - Intergenic
1000912949 5:167044471-167044493 CATATTTCTCATCTGAACACTGG - Intergenic
1001466052 5:171967524-171967546 TATATTTATTAAATGAACATGGG - Intronic
1003372575 6:5543021-5543043 CATTTTTTTCAAGTGTACATGGG - Intronic
1003705994 6:8530490-8530512 CATATTTATCACCTAGAAACAGG + Intergenic
1008411578 6:51186609-51186631 CATATTTAACAACTGGAGATTGG + Intergenic
1008772423 6:54994802-54994824 CATTTTTCTCATCTGCACATGGG + Intergenic
1010183440 6:73115311-73115333 CATCTTTATTAGCTGGATATTGG - Intronic
1013668102 6:112368055-112368077 CAGATTTTGTAACTGGACATTGG - Intergenic
1015765763 6:136714594-136714616 CATATTTATCAACAGATCATTGG - Intronic
1016262967 6:142195969-142195991 CATTCTTTTCAACTGCACATGGG - Intronic
1018069538 6:160151091-160151113 CATTTTTATCATCAGGATATAGG + Intronic
1018516990 6:164593450-164593472 CATATTTTACAACAGGAAATAGG - Intergenic
1023288902 7:38648617-38648639 AATATTCATCAACTGATCATTGG + Intergenic
1025153251 7:56577795-56577817 CATATTTAGCAAGTGGCCGTGGG - Intergenic
1025238185 7:57249110-57249132 CATATTTACCAAGTTGCCATGGG + Intergenic
1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG + Intergenic
1025764131 7:64426355-64426377 CATATTTAGCAAGTGGTCATGGG + Intergenic
1028606564 7:92662276-92662298 CATCTTAATTAACTGGAGATGGG + Intronic
1032401412 7:131626884-131626906 AATATTTATCAAATGAACAAAGG - Intergenic
1033960007 7:146903062-146903084 CATTTTTATCAACTTCACGTTGG + Intronic
1034826101 7:154264471-154264493 CATTTTTTTCAAGTGGAAATAGG - Intronic
1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG + Intronic
1037124652 8:15332963-15332985 CATAGCTATCAACTGTTCATTGG - Intergenic
1038317274 8:26497348-26497370 GATATTTCTCAACAGTACATGGG + Intronic
1038989425 8:32850851-32850873 CATTTTTCTCAAGTGCACATAGG - Intergenic
1045125977 8:99089479-99089501 AATATATATCAAATGTACATTGG + Intronic
1046290828 8:112158237-112158259 CTTATGTATCGACAGGACATGGG - Intergenic
1046953720 8:120042418-120042440 CATTTTTACTAACAGGACATTGG + Intronic
1048224057 8:132567811-132567833 CATATTTGGCATCTGGAGATGGG - Intergenic
1050379594 9:5013038-5013060 CATATTGATGGACTGGATATAGG + Intronic
1050924935 9:11252297-11252319 CATTTTTCTCAAATGCACATGGG + Intergenic
1051086495 9:13355553-13355575 CTTAGTTATCAAATGGATATAGG + Intergenic
1054783530 9:69188415-69188437 CAAATTCATCAAATGGACCTTGG - Intronic
1054873595 9:70072551-70072573 CAAATCTATGAGCTGGACATTGG + Intronic
1055459826 9:76509031-76509053 CATATTTTTCATCTGGATTTTGG - Intergenic
1056711486 9:88995349-88995371 TTTATTTTTCAACTTGACATGGG + Exonic
1057003540 9:91535102-91535124 GTTATTTCTCATCTGGACATTGG + Intergenic
1057529239 9:95829852-95829874 CATATCTAACAACTGGACTTCGG - Intergenic
1058378579 9:104354005-104354027 CATATCTATCAATTGGAAAAAGG + Intergenic
1058761039 9:108132500-108132522 GAAATTTATCAGCTGCACATTGG + Intergenic
1060986779 9:127824661-127824683 CATTTTTCTCATCTGCACATGGG - Intronic
1061892138 9:133628015-133628037 CATATTTATCAACAGGGAGTTGG + Intergenic
1185808792 X:3085774-3085796 CATATTTATCACCTTCACTTGGG - Intronic
1186900348 X:14048454-14048476 CATAGTTATAAAATGTACATAGG + Intergenic
1189177847 X:38975844-38975866 CAATTTTCTCATCTGGACATGGG + Intergenic
1189862973 X:45292183-45292205 TATATTTATCAACTGGAAGATGG - Intergenic