ID: 1164094680

View in Genome Browser
Species Human (GRCh38)
Location 19:21996645-21996667
Sequence AGGTGTTACCTGAACATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 5, 3: 25, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164094678_1164094680 -1 Left 1164094678 19:21996623-21996645 CCTGCATGGGTAAAGTAGCAATA 0: 1
1: 0
2: 5
3: 99
4: 2022
Right 1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG 0: 1
1: 1
2: 5
3: 25
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164094680 Original CRISPR AGGTGTTACCTGAACATTTG TGG Intronic
905637738 1:39566318-39566340 ATTGGTTACCTGAACATTTTAGG - Intronic
906906977 1:49905545-49905567 AGATGATACCTAAATATTTGGGG + Intronic
907423096 1:54360657-54360679 AGCTGTTACCTAAACATTTTGGG - Intronic
908516635 1:64898791-64898813 AGGTGCTCCCTGAACATTTCTGG + Intronic
912543929 1:110437523-110437545 AGATGTCACCTCAACATTTTAGG - Intergenic
912877428 1:113375018-113375040 AGGTGATTCCTGAACAATTATGG - Intergenic
913672557 1:121111282-121111304 AGGTCTTCCCTGAACATCTTAGG - Intergenic
914024326 1:143898647-143898669 AGGTCTTCCCTGAACATCTTAGG - Intergenic
914662808 1:149806668-149806690 AGGTCTTCCCTGAACATCTTAGG - Intronic
915795776 1:158732026-158732048 AGGTGGTTCCTGAATATTTATGG - Intergenic
919326912 1:196119633-196119655 AAATTTTATCTGAACATTTGAGG - Intergenic
919484190 1:198126992-198127014 AGGAGATACCTGAACATTGGTGG - Intergenic
920250826 1:204621200-204621222 AGGTCTTACCTGCACAGCTGAGG - Exonic
923605968 1:235443089-235443111 AGGGGAGACCTGAACTTTTGGGG - Intronic
1062956728 10:1545360-1545382 CAGTGTGATCTGAACATTTGGGG + Intronic
1063020174 10:2119149-2119171 AGCTGTTACCTGACCACTTTGGG + Intergenic
1063281194 10:4631386-4631408 AGGTGAGACCTGCACATGTGAGG + Intergenic
1063631880 10:7741567-7741589 AGGTGTGAACTGAACATTTCTGG + Intronic
1063857409 10:10270945-10270967 AGGTGATATTTAAACATTTGAGG - Intergenic
1064465559 10:15576726-15576748 AGATGTTTTCCGAACATTTGTGG - Intronic
1066305905 10:34140768-34140790 AGGTGTTTGGTGAACATATGGGG - Intronic
1066975095 10:42360884-42360906 AGGTGTTAACTGCACATTTATGG + Intergenic
1069233504 10:66041454-66041476 AGATGTTACCTTAACATTCAGGG + Intronic
1071255613 10:83869296-83869318 AGGTGATCTCTGAACATTTGGGG + Intergenic
1071560292 10:86641191-86641213 AGGTAGTACCTGATCAATTGTGG - Intergenic
1071800320 10:89053183-89053205 AGGTGCTCCCTGAATGTTTGTGG + Intergenic
1073543150 10:104328444-104328466 TGGTTTTGCCTGAACGTTTGTGG - Intronic
1073591535 10:104762231-104762253 ACATGTTGCCTGACCATTTGTGG + Intronic
1074484136 10:113855824-113855846 AGGGGATACCTAAACACTTGAGG + Intronic
1079830416 11:25259626-25259648 CGGTGTTGCCTGCAAATTTGGGG - Intergenic
1080562934 11:33480617-33480639 AGGGGTTACCAGAAATTTTGGGG + Intergenic
1080990843 11:37532983-37533005 GGGGGTTACATTAACATTTGAGG - Intergenic
1081626973 11:44661943-44661965 ATGTGTTATCTGCACATCTGTGG + Intergenic
1083141885 11:60728904-60728926 AGAAGTTACCAGAGCATTTGGGG + Intergenic
1086315509 11:85587737-85587759 AGCTGTTGCCTGAACATCTTGGG + Intronic
1088952611 11:114586681-114586703 TGGTGTTACCTGAAGGTTTCTGG + Intronic
1089036398 11:115397919-115397941 AAGTCTTCCCTGAATATTTGGGG + Intronic
1093327954 12:17802919-17802941 AGCTGTTACCTGCACTTCTGTGG - Intergenic
1093369059 12:18344185-18344207 AGGGGTTAGTTGAACATCTGAGG - Intronic
1093826995 12:23704960-23704982 AGATGTTACTTGAATATTTCTGG + Intronic
1096023327 12:48340061-48340083 GGGTGAAACATGAACATTTGAGG + Exonic
1096449841 12:51729250-51729272 AGGAGTTATCTGAGCAATTGAGG + Intronic
1097670006 12:62524626-62524648 AGGTTTTACCTTAATAGTTGAGG - Exonic
1100795762 12:98180210-98180232 TGGTCTTACCTGTACATTTCAGG - Intergenic
1101322467 12:103684881-103684903 AGGTGATAACTGCAAATTTGGGG - Intronic
1101428286 12:104605740-104605762 AGGTGTCAACTGCATATTTGTGG + Intronic
1101939720 12:109090845-109090867 TGTTCTTACATGAACATTTGGGG - Intronic
1105230510 13:18490880-18490902 AGGTGTTAACTGCACATTTTTGG + Intergenic
1110408874 13:75182521-75182543 AGGTATTACCTGTAGATTTTGGG - Intergenic
1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG + Intronic
1112237417 13:97648938-97648960 GGGTCTTACCTGAACCTCTGGGG + Intergenic
1112726523 13:102310823-102310845 AGGAGTTAACTAATCATTTGGGG + Intronic
1113034005 13:106028439-106028461 AGGTGTGACCTGTACATAAGGGG - Intergenic
1114014770 14:18417692-18417714 AGGTGTTAACTACACATTTATGG + Intergenic
1118384169 14:65241545-65241567 GGGAATTACCTGAATATTTGGGG - Intergenic
1119627700 14:76195055-76195077 AAGTGTTCCTTGAACATTTGGGG - Intronic
1120511433 14:85420844-85420866 AGGTGTTTCATGCATATTTGTGG - Intergenic
1121898422 14:97670610-97670632 AGGTGTTACCTTAAACTGTGGGG - Intergenic
1124073345 15:26416190-26416212 AGGTGTGACATGCACATTTTTGG + Intergenic
1124176829 15:27433949-27433971 TTGTGTTTCCTAAACATTTGGGG - Intronic
1124452303 15:29806432-29806454 GGGTGTTCCTTGAAGATTTGTGG - Intronic
1125433032 15:39616523-39616545 AAGGGGTACCTGAACATTTCTGG + Intronic
1127275486 15:57439588-57439610 TAGTGTTACCTGAGTATTTGAGG - Exonic
1129082113 15:73051478-73051500 ACGTTTTACCTGTACCTTTGCGG - Intergenic
1131581049 15:93643978-93644000 AGGGTTGGCCTGAACATTTGGGG + Intergenic
1132424987 15:101708603-101708625 ATCTATTTCCTGAACATTTGAGG - Intronic
1133510472 16:6452568-6452590 AAGTGATACCTGAACAATAGGGG + Intronic
1133895766 16:9927400-9927422 AGGTGTTACCAGCAAACTTGAGG + Intronic
1134437394 16:14273400-14273422 AGCTGTTACCTGTAATTTTGGGG - Intergenic
1135336049 16:21601815-21601837 TGGTGTTTTCTGAATATTTGGGG + Intronic
1137037953 16:35582648-35582670 AGGGGTTATCTGCACATTTGTGG + Intergenic
1137899270 16:52246893-52246915 AGGTGTTAGCAGAATATTTTTGG - Intergenic
1138724325 16:59119491-59119513 AGTTGTTTCCTGAACACGTGTGG - Intergenic
1138841601 16:60515467-60515489 AAGTGTTCCCTGGATATTTGGGG - Intergenic
1144006570 17:11105868-11105890 AGGTGTGACCTTAATAGTTGGGG - Intergenic
1146922759 17:36724384-36724406 AGGTGTTTCCTGGGCATTCGTGG + Intergenic
1149912703 17:60580977-60580999 AGCTGTTTCTTGAAGATTTGTGG + Intronic
1150199991 17:63345082-63345104 AGGGGTTACCTGAATGTCTGGGG - Intronic
1153547912 18:6228185-6228207 AGTTGTTTCAGGAACATTTGTGG - Intronic
1154522894 18:15248988-15249010 AGGTGTTAACTGCACATTTATGG - Intergenic
1157139394 18:45090520-45090542 AGGTGTAACTTAAAGATTTGAGG - Intergenic
1158952317 18:62505740-62505762 AGGTGTTGGCAGAACATTTAGGG + Intergenic
1160454424 18:78990042-78990064 AGAAATTACCTGAAGATTTGAGG + Intronic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1163904058 19:20135947-20135969 AGGTGTTAACTGCACATTTGTGG + Intergenic
1163936041 19:20444839-20444861 AGGTTTTACCTGCACATTTGTGG - Intergenic
1163970239 19:20786489-20786511 AGGTATTACCTGTACGTTTGTGG - Intronic
1164022055 19:21316510-21316532 AGGTATTACTTGCACATTTGTGG + Intronic
1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG + Intronic
1164102268 19:22067383-22067405 AGGTGTTACCTGCATATTTGTGG - Intronic
1164114252 19:22202123-22202145 AGGTGGTATCTGAATATTTGTGG + Intergenic
1164124595 19:22300849-22300871 AGGTTTTCCCTGCACATTTGTGG - Intronic
1164139861 19:22449619-22449641 AGGTGTTATTTGCATATTTGTGG - Intronic
1164140675 19:22459221-22459243 AGGTGGTACCTGCACATTTGTGG - Intronic
1164175775 19:22772860-22772882 AGGTGTTCCCTGCACATCTGTGG + Intronic
1164183624 19:22841815-22841837 AGGTGTTACTTGCATATTTGTGG - Intergenic
1164198393 19:22993979-22994001 AAGTGTTACCTGAACATTTGTGG + Intronic
925595040 2:5547259-5547281 AAGTGTTTCCTGATCATTTGAGG + Intergenic
927292400 2:21417662-21417684 AGGTGTTCAATGAATATTTGTGG + Intergenic
930102967 2:47617422-47617444 TGGTGTTGCCTGCACATTTGAGG - Intergenic
931693025 2:64851439-64851461 GTGTGTTACCTGAGCACTTGAGG + Intergenic
933174531 2:79160127-79160149 AGGTGTTAAGTGAAGATTTACGG + Intergenic
935315006 2:101824060-101824082 GGATGTTTCCTGAGCATTTGTGG + Intronic
935552448 2:104472314-104472336 AGATGTTACCTGAACCTTGAAGG + Intergenic
938522183 2:132081835-132081857 AGGTGTTAACTGCACATTTATGG - Intergenic
938622243 2:133068200-133068222 AGGGCATACCTGAACCTTTGTGG + Intronic
944395826 2:199264902-199264924 AAGTGTTACCTTCACATATGGGG - Intergenic
944887164 2:204074973-204074995 AAGTGTTACTTCAACTTTTGAGG - Intergenic
945468139 2:210195278-210195300 ATGTGTAACCCGAGCATTTGTGG - Exonic
945921799 2:215762467-215762489 AGCTGTGACCTGAACTTTAGTGG - Intergenic
947236232 2:227944072-227944094 TGGTGATACCTGAACAGCTGGGG - Intergenic
1169522884 20:6392020-6392042 AGGTTTCACCTGAATGTTTGGGG + Intergenic
1173958649 20:47054250-47054272 AGGTGTTCAGTGAATATTTGTGG + Intronic
1176774501 21:13119227-13119249 AGGTGTTAACTGCACATTTATGG + Intergenic
1176981392 21:15385192-15385214 ATATGTTAACTGACCATTTGGGG + Intergenic
1177615973 21:23520426-23520448 AATTGTTGCCTGAACTTTTGGGG + Intergenic
1179420028 21:41228058-41228080 AGGTGTTGGCTGAAGGTTTGGGG - Intronic
1180439270 22:15348468-15348490 AGGTGTTAACTACACATTTATGG + Intergenic
1180522123 22:16218943-16218965 AGGTATTAACTGCACATTTATGG + Intergenic
1181441569 22:22938652-22938674 AGGTGTGACCTTAGCATTGGAGG + Intergenic
1181908029 22:26215274-26215296 AGGTGTTACATGCACAATGGTGG + Intronic
1183347577 22:37316425-37316447 AGGTGCTCCATAAACATTTGTGG - Intergenic
1184936806 22:47730628-47730650 AGGGGTTACATAAACATCTGTGG - Intergenic
956411865 3:68987767-68987789 GTATGTTACATGAACATTTGGGG + Intronic
957598932 3:82306626-82306648 TGTTGTTGCCTGCACATTTGAGG - Intergenic
961429991 3:126874705-126874727 ATCTGTTACCTGGACCTTTGTGG + Intronic
964640258 3:158902065-158902087 AGGTGTAACCAGAACATGTTGGG + Intergenic
965647753 3:170901801-170901823 AGGTGTTACCTAAACAAGTCTGG - Intronic
965783683 3:172314493-172314515 AGGGGATACCTGGACATTAGTGG - Intronic
966018956 3:175182765-175182787 TTTTGTTACCTGAACTTTTGGGG + Intronic
966249414 3:177846368-177846390 AGGTGTTTCATGAATAATTGTGG - Intergenic
966702419 3:182869852-182869874 ACTTGTTAGCTGGACATTTGGGG - Intronic
968936706 4:3614808-3614830 AGGTATTCACTGAACATTTCTGG - Intergenic
970851962 4:20613760-20613782 AGGTGTTGCCTCAGCATCTGGGG + Intronic
970860126 4:20692969-20692991 AGGTGTTTTCTCAACATTTCTGG + Intergenic
973228616 4:47816426-47816448 AGATGTTACATAAGCATTTGTGG - Intronic
975064513 4:70043514-70043536 ATTTGTTGCCTGAACATGTGGGG - Intergenic
979117243 4:116841108-116841130 TGGTGTTGGGTGAACATTTGTGG - Intergenic
979301854 4:119095502-119095524 AAATGTTACCTGAACACTAGTGG + Intergenic
979604745 4:122625957-122625979 AGCTGTTACCTGAACATCGTTGG - Intergenic
984185865 4:176543153-176543175 TGGTGTTGCCTGAGGATTTGGGG + Intergenic
984439325 4:179746646-179746668 CTGTGTTACCTGAAAATGTGTGG - Intergenic
984498326 4:180526929-180526951 AGGTGTTCAGTAAACATTTGTGG - Intergenic
984728544 4:183044401-183044423 TTTTGTTGCCTGAACATTTGGGG - Intergenic
993993602 5:94691231-94691253 TGGTGTTCTCTGATCATTTGGGG + Intronic
994278314 5:97866906-97866928 AGGTGTTACATGAACAAATATGG + Intergenic
995063726 5:107838352-107838374 AGTTGTTTCCTGAACATATATGG - Intergenic
995252672 5:110012251-110012273 AGCTGTTACTTGAAAATGTGAGG - Intergenic
995804229 5:116033407-116033429 AAGTGTTCTCAGAACATTTGAGG + Intronic
996911168 5:128658927-128658949 AGGTGATACCATGACATTTGAGG + Intronic
1000045883 5:157521686-157521708 AGGTACTCCCTGAACATCTGGGG + Intronic
1001219993 5:169892368-169892390 AGGAGCTAGGTGAACATTTGTGG + Intronic
1005269190 6:24145409-24145431 AAGTGTTTCCTGCAAATTTGGGG + Intronic
1005412943 6:25569682-25569704 ATGTGTTACCTGAAGAATTTAGG + Intronic
1005718498 6:28577005-28577027 AGCTATTACATCAACATTTGAGG + Intronic
1006803401 6:36773550-36773572 AGGGGTTCCCTAAACATTTGTGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007943569 6:45804794-45804816 AGGTATTGTATGAACATTTGTGG + Intergenic
1008837898 6:55859957-55859979 AGGTGTTGTCTGAAATTTTGTGG - Intronic
1011061797 6:83278358-83278380 AGGTTTTGACTGAAGATTTGAGG + Intronic
1014450775 6:121578952-121578974 AGGTCTTACCAGAAGATGTGTGG - Intergenic
1015313499 6:131791638-131791660 AGATGTCAGCTGAACATTTCTGG + Intergenic
1020717417 7:11693118-11693140 AGGTGTTTCCTGAAAAGTTTAGG - Intronic
1024684340 7:51729095-51729117 AGTGGTTACCTGTCCATTTGTGG - Intergenic
1025774742 7:64550508-64550530 AGGTGTCACCTGCAGATTTATGG + Intronic
1025866113 7:65382741-65382763 AAGTGTTACCTGCACATTTGTGG - Intronic
1026439111 7:70427702-70427724 AGTAGTTACCTGAACATTGTTGG + Intronic
1027868482 7:83676039-83676061 ATCTGTTACCTGAACCTTTCTGG + Intergenic
1032101469 7:128982096-128982118 AGCTGTTACCTGAAGTTCTGGGG - Intronic
1035131417 7:156657771-156657793 ATCTGTTACATAAACATTTGTGG - Intronic
1035734314 8:1876737-1876759 ACGTGTTCCCTGCACATGTGAGG + Intronic
1038891770 8:31733624-31733646 AGGTGTAACCTGGACTTTTCTGG - Intronic
1042007867 8:64202548-64202570 AGGTGTTTCCTGAAAAATTGGGG - Intergenic
1042351515 8:67782046-67782068 AACTGTTACATGAATATTTGCGG + Intergenic
1043286539 8:78538791-78538813 AGGTGTTACCGTAGCATATGTGG + Intronic
1050587309 9:7125867-7125889 AGTTGATACCTGAGCTTTTGAGG + Intergenic
1053700874 9:40688969-40688991 AGGTGTTAACTGCACATTCATGG - Intergenic
1054312167 9:63488367-63488389 AGGTGTTAACTGCACATTCATGG - Intergenic
1054410941 9:64812425-64812447 AGGTGTTAACTGCACATTCATGG - Intergenic
1055144071 9:72911740-72911762 CTGTGTTGGCTGAACATTTGTGG + Intronic
1056432669 9:86543650-86543672 ATGTGTGACCTGAGCATCTGTGG + Intergenic
1186192971 X:7084096-7084118 AGCTGTTACCTGCATCTTTGCGG + Intronic
1188618614 X:32191658-32191680 ATATGTCACTTGAACATTTGTGG - Intronic
1190828941 X:54043690-54043712 GTGAGGTACCTGAACATTTGGGG - Intronic
1194003561 X:88462486-88462508 TTTTGTTACCTGAACTTTTGAGG - Intergenic
1195150673 X:102066545-102066567 AGGTTTCATCTGAACTTTTGTGG - Intergenic
1195400676 X:104458067-104458089 TGGTGTTGCCTGAACATGTAGGG - Intergenic
1195455030 X:105058490-105058512 ACATGTTACCTGAACATATGTGG + Intronic
1197538056 X:127716134-127716156 TTGTGTTGCCTGAACTTTTGGGG - Intergenic
1201585054 Y:15551419-15551441 AGGTAATACCTTAGCATTTGTGG + Intergenic