ID: 1164096991

View in Genome Browser
Species Human (GRCh38)
Location 19:22020559-22020581
Sequence TTGGGCAATGACGGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164096979_1164096991 6 Left 1164096979 19:22020530-22020552 CCACCATGACCACTTTGTTCATG No data
Right 1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG No data
1164096977_1164096991 18 Left 1164096977 19:22020518-22020540 CCTCCATCTCTGCCACCATGACC No data
Right 1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG No data
1164096978_1164096991 15 Left 1164096978 19:22020521-22020543 CCATCTCTGCCACCATGACCACT No data
Right 1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG No data
1164096982_1164096991 3 Left 1164096982 19:22020533-22020555 CCATGACCACTTTGTTCATGGGC No data
Right 1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG No data
1164096983_1164096991 -3 Left 1164096983 19:22020539-22020561 CCACTTTGTTCATGGGCCTATTG 0: 11
1: 159
2: 216
3: 200
4: 342
Right 1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164096991 Original CRISPR TTGGGCAATGACGGGGTGGC TGG Intergenic
No off target data available for this crispr