ID: 1164097089

View in Genome Browser
Species Human (GRCh38)
Location 19:22021374-22021396
Sequence AGTTATCTGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164097085_1164097089 15 Left 1164097085 19:22021336-22021358 CCAGTAATAGGCCAAGAGTTGTC No data
Right 1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG No data
1164097084_1164097089 16 Left 1164097084 19:22021335-22021357 CCCAGTAATAGGCCAAGAGTTGT No data
Right 1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG No data
1164097083_1164097089 22 Left 1164097083 19:22021329-22021351 CCAAAGCCCAGTAATAGGCCAAG 0: 17
1: 191
2: 171
3: 92
4: 154
Right 1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG No data
1164097087_1164097089 4 Left 1164097087 19:22021347-22021369 CCAAGAGTTGTCTCTCAAAAGGA 0: 17
1: 200
2: 191
3: 170
4: 310
Right 1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164097089 Original CRISPR AGTTATCTGCAGAAAATGGC AGG Intergenic
No off target data available for this crispr