ID: 1164100704

View in Genome Browser
Species Human (GRCh38)
Location 19:22052296-22052318
Sequence GCCTGAAAAGGCTGGAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 7, 2: 13, 3: 22, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164100696_1164100704 17 Left 1164100696 19:22052256-22052278 CCTTTGGGTTGGGCCTGGCTCAG No data
Right 1164100704 19:22052296-22052318 GCCTGAAAAGGCTGGAGCTTAGG 0: 1
1: 7
2: 13
3: 22
4: 207
1164100700_1164100704 4 Left 1164100700 19:22052269-22052291 CCTGGCTCAGCTCAGGGAGGAAA 0: 1
1: 14
2: 14
3: 41
4: 312
Right 1164100704 19:22052296-22052318 GCCTGAAAAGGCTGGAGCTTAGG 0: 1
1: 7
2: 13
3: 22
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164100704 Original CRISPR GCCTGAAAAGGCTGGAGCTT AGG Intergenic