ID: 1164106106

View in Genome Browser
Species Human (GRCh38)
Location 19:22107920-22107942
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164106100_1164106106 -1 Left 1164106100 19:22107898-22107920 CCGGGCGGAGAGGCTCCTCACTT 0: 275
1: 2694
2: 8362
3: 5948
4: 4283
Right 1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1164106096_1164106106 16 Left 1164106096 19:22107881-22107903 CCCAGATGGGGTGGCTGCCGGGC 0: 236
1: 870
2: 3957
3: 4312
4: 3171
Right 1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1164106097_1164106106 15 Left 1164106097 19:22107882-22107904 CCAGATGGGGTGGCTGCCGGGCG 0: 278
1: 1047
2: 1380
3: 2469
4: 3112
Right 1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1164106093_1164106106 24 Left 1164106093 19:22107873-22107895 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164106106 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intergenic
Too many off-targets to display for this crispr