ID: 1164112293

View in Genome Browser
Species Human (GRCh38)
Location 19:22178711-22178733
Sequence CCGTGCAAATTTAATAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164112293_1164112298 30 Left 1164112293 19:22178711-22178733 CCAAATTTATTAAATTTGCACGG No data
Right 1164112298 19:22178764-22178786 AAAGTTGGAACAACTACCTAAGG No data
1164112293_1164112295 15 Left 1164112293 19:22178711-22178733 CCAAATTTATTAAATTTGCACGG No data
Right 1164112295 19:22178749-22178771 TCCCTGATGTTTAGCAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164112293 Original CRISPR CCGTGCAAATTTAATAAATT TGG (reversed) Intergenic
No off target data available for this crispr