ID: 1164117247

View in Genome Browser
Species Human (GRCh38)
Location 19:22234458-22234480
Sequence GACCCACTTTGTGGTTAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164117241_1164117247 27 Left 1164117241 19:22234408-22234430 CCGATCACATATATACCACATCC No data
Right 1164117247 19:22234458-22234480 GACCCACTTTGTGGTTAGATGGG No data
1164117244_1164117247 6 Left 1164117244 19:22234429-22234451 CCATTTGATGATGGAATGCTGTT No data
Right 1164117247 19:22234458-22234480 GACCCACTTTGTGGTTAGATGGG No data
1164117240_1164117247 28 Left 1164117240 19:22234407-22234429 CCCGATCACATATATACCACATC No data
Right 1164117247 19:22234458-22234480 GACCCACTTTGTGGTTAGATGGG No data
1164117243_1164117247 12 Left 1164117243 19:22234423-22234445 CCACATCCATTTGATGATGGAAT No data
Right 1164117247 19:22234458-22234480 GACCCACTTTGTGGTTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164117247 Original CRISPR GACCCACTTTGTGGTTAGAT GGG Intergenic
No off target data available for this crispr