ID: 1164117261

View in Genome Browser
Species Human (GRCh38)
Location 19:22234605-22234627
Sequence AGTTATCTGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164117259_1164117261 4 Left 1164117259 19:22234578-22234600 CCAAGAGTTGTCTCTCAAAAGGA 0: 17
1: 200
2: 191
3: 170
4: 310
Right 1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG No data
1164117257_1164117261 15 Left 1164117257 19:22234567-22234589 CCAGTAACAGGCCAAGAGTTGTC 0: 17
1: 171
2: 183
3: 131
4: 176
Right 1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG No data
1164117256_1164117261 16 Left 1164117256 19:22234566-22234588 CCCAGTAACAGGCCAAGAGTTGT 0: 17
1: 184
2: 186
3: 148
4: 230
Right 1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG No data
1164117255_1164117261 22 Left 1164117255 19:22234560-22234582 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164117261 Original CRISPR AGTTATCTGCAGAAAATGGC AGG Intergenic
No off target data available for this crispr