ID: 1164138702

View in Genome Browser
Species Human (GRCh38)
Location 19:22438094-22438116
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 2, 1: 4, 2: 15, 3: 32, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164138702_1164138705 25 Left 1164138702 19:22438094-22438116 CCATTACTCTTCTGAATGGGCAT 0: 2
1: 4
2: 15
3: 32
4: 222
Right 1164138705 19:22438142-22438164 GCTTAGCATAAATGAAGCAATGG 0: 2
1: 0
2: 1
3: 15
4: 174
1164138702_1164138703 3 Left 1164138702 19:22438094-22438116 CCATTACTCTTCTGAATGGGCAT 0: 2
1: 4
2: 15
3: 32
4: 222
Right 1164138703 19:22438120-22438142 TTGTTAGATCATTTTTTCCATGG 0: 2
1: 0
2: 6
3: 32
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164138702 Original CRISPR ATGCCCATTCAGAAGAGTAA TGG (reversed) Intronic
900233652 1:1575608-1575630 TTGCGCATTCAGGAAAGTAATGG + Intergenic
900859572 1:5218444-5218466 ATGCCCATGAAGAAGAGCAGGGG + Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
905679574 1:39858945-39858967 ATGCACATTAAGAAAACTAAAGG + Intronic
910549863 1:88463282-88463304 ATGCCTATTCAGAAAAGAACAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
912127211 1:106554156-106554178 TTGCCCATTCAGTATAATAATGG - Intergenic
912278612 1:108288667-108288689 ATGCCCATTGAGTATAATAATGG - Intergenic
912289614 1:108405690-108405712 ATGCCCATTGAGTATAATAATGG + Intronic
914325809 1:146614935-146614957 ATAACCATTAAGAAGAATAAGGG + Intergenic
917873831 1:179267078-179267100 ATCCACATTCAAAAGAGTGAAGG - Intergenic
919254258 1:195100507-195100529 ATCCCCTTTGAGAAGGGTAAGGG + Intergenic
919658401 1:200219493-200219515 GTGCCCGTTCAAAAGAGGAAGGG - Intergenic
921571364 1:216783057-216783079 ATTCCCACTCAGAAGAGTTAGGG + Intronic
921637930 1:217519137-217519159 ATCCCCATACAGAAGAATAAAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922382971 1:225051649-225051671 ATGGCCATTGAGAAGCGTATTGG + Intronic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923057096 1:230435038-230435060 TTGCCCATTCTGGAGAGCAATGG - Intergenic
1065778960 10:29149007-29149029 AAGGCCTTGCAGAAGAGTAAGGG - Intergenic
1066459590 10:35601502-35601524 GGGCCAATTCAGAAGAGAAACGG - Intergenic
1066785233 10:38995936-38995958 ATGCCTCTACATAAGAGTAAAGG - Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067371752 10:45690441-45690463 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067388029 10:45835708-45835730 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067418092 10:46121572-46121594 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067446236 10:46348893-46348915 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067503451 10:46828135-46828157 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067591142 10:47511878-47511900 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067638260 10:48019970-48019992 ATGCCTCTCCATAAGAGTAAGGG + Intergenic
1067875234 10:50000391-50000413 ATGCCTCTCCATAAGAGTAAGGG - Intronic
1068436308 10:56995434-56995456 ATGTACATGAAGAAGAGTAAAGG + Intergenic
1068902434 10:62283841-62283863 ATGCCCCTGCAGCAGACTAAAGG - Intergenic
1070134865 10:73684396-73684418 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1073257393 10:102161850-102161872 ATCCCCATTCCGAAGGGTCAGGG + Exonic
1073319304 10:102604696-102604718 AAGCTCATTCAGGAGAGTAGGGG + Intronic
1075953054 10:126498567-126498589 ATGGCCATTCAGCAGTGTGATGG + Intronic
1076308431 10:129482629-129482651 AGGCCATTTCATAAGAGTAAAGG - Intronic
1076449424 10:130546249-130546271 ATGCCCATAGAGAATGGTAAAGG - Intergenic
1077036792 11:499278-499300 ATGCCCAGGCAGAAGACTGAGGG - Intronic
1079975031 11:27080328-27080350 ATGACCATTCAGTGTAGTAATGG - Intronic
1080410453 11:32019257-32019279 CAGCCCATGCAGAAGAGTACAGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083183271 11:61002206-61002228 ATGCCCATTCACAGGGGAAACGG - Intronic
1085215611 11:74827868-74827890 TTGCCCATTCAGAATGGTATTGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085824539 11:79830640-79830662 TTGCCCAGTCAAAAGAGCAAAGG + Intergenic
1086125977 11:83349090-83349112 ATGGGCATTCAGAAGAGAAAAGG - Intergenic
1086178915 11:83926262-83926284 ATCCACATTTAGAAGAATAAAGG - Intronic
1087342388 11:96923383-96923405 ATCCGCATGCAGAAGAATAAAGG - Intergenic
1087740016 11:101876651-101876673 TTGCCCATTCAGTATAGTATTGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088577371 11:111284911-111284933 ATGCTCATAGAGAATAGTAAAGG + Intronic
1089739584 11:120573274-120573296 ATGCCCACACAGATGACTAAAGG - Intronic
1089789115 11:120929725-120929747 ACGCCCAACCAGAAGAGGAAGGG - Intronic
1089909028 11:122076886-122076908 ATGCCCATTCACAAAAGCATGGG - Intergenic
1090006051 11:123003147-123003169 ATGCCTGTTCAGAGTAGTAAAGG - Intergenic
1090361819 11:126177988-126178010 ATACCCATTCAGGAGTTTAATGG + Intergenic
1092101305 12:5885928-5885950 ATGCCCATGGAGAAGAGCAGTGG - Intronic
1092955675 12:13547369-13547391 ATGGCCACCCAGAAGAGGAAAGG + Exonic
1096959535 12:55564373-55564395 TTGCCCATTCAGTAGAATATAGG - Intergenic
1097095378 12:56543443-56543465 TTGCCCAGGCTGAAGAGTAATGG - Intronic
1097670499 12:62531414-62531436 ATTCACATGCAGAAGAGTGATGG - Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100083933 12:90884445-90884467 ATGCACATTCATAAGAGGGAGGG - Intergenic
1100116804 12:91315619-91315641 AGTCCCATTCAGAAGAGAGAAGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100752383 12:97712972-97712994 AAGCTCATTCAGAAAAATAAAGG - Intergenic
1101606713 12:106252296-106252318 AAGTCCATGCAGAAGAGGAAGGG + Intronic
1102242454 12:111333508-111333530 TTGCCCTTTCTGAAGAGTAGAGG + Intronic
1102817651 12:115880650-115880672 ATGCAAATTCAGAAAAATAATGG + Intergenic
1104166020 12:126230370-126230392 ATGCCCATTCAGGGGGGCAAGGG - Intergenic
1105449808 13:20489359-20489381 ATGCACATTCAGGTGAGTGAAGG - Exonic
1106992555 13:35439489-35439511 AAGGCCATTCAAAGGAGTAAGGG - Intronic
1107616632 13:42174869-42174891 CTGTCCCTTCAGAAGAGTAGGGG - Intronic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1110501698 13:76235790-76235812 ATGCCAATTCAGCATAGTATTGG - Intergenic
1111496012 13:89051777-89051799 ATTCCCCTTCAGAATAGAAAGGG + Intergenic
1111640997 13:90969637-90969659 AAGCCCTTTCAGAAGAATAGGGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1116032999 14:39595463-39595485 TTGCCCATTCAGAATGATAATGG - Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1117507393 14:56416993-56417015 ATGGCAATGCAGAAGTGTAAAGG + Intergenic
1117605186 14:57421658-57421680 ATGCCCCTTCAGAATTGTGAGGG - Intergenic
1117774522 14:59169071-59169093 ATTCACATTCAGAAGAATGAAGG + Intergenic
1117777314 14:59196234-59196256 GTGCCCAAGAAGAAGAGTAAAGG + Intronic
1118661181 14:68014744-68014766 ATTCACATTCAGAATAGTACAGG - Intronic
1118913047 14:70077805-70077827 CTGCCCAGGCAAAAGAGTAAAGG - Intronic
1119089695 14:71770272-71770294 ATCCTCATACAGAAGAATAAAGG - Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122381998 14:101314466-101314488 TTGCCCATTCTGAAGTGCAATGG + Intergenic
1124951394 15:34324489-34324511 ATGCCCATTCTTCAGAGGAATGG + Intronic
1125121379 15:36162528-36162550 ATTCCCATTCAGAAGCAAAAAGG - Intergenic
1127173275 15:56326596-56326618 AGAACAATTCAGAAGAGTAAAGG + Intronic
1127511666 15:59648059-59648081 ATGCCCATAGATAAAAGTAATGG - Intronic
1127519200 15:59726676-59726698 ATGCCCATTAAGGAGAATAAAGG + Intergenic
1127997458 15:64161875-64161897 TTGCCCTTTCTTAAGAGTAATGG - Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129304856 15:74652542-74652564 ATTCACATTTAGAAGAGAAAAGG + Intronic
1131710911 15:95055114-95055136 AAGACCATTCAGAAGATAAATGG - Intergenic
1135344629 16:21678387-21678409 ATGGACATTCAGAAGACAAAAGG - Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1137040235 16:35604327-35604349 GTGCCCATTCAGAAAAGTCAAGG + Intergenic
1138256642 16:55569714-55569736 ATACAAATTCAGAAGAGAAAAGG - Intronic
1140007756 16:71096007-71096029 ATAACCATTAAGAAGAATAAGGG - Intronic
1140751958 16:78032950-78032972 AAGCCCATTCAGAAAGGCAATGG + Intronic
1143461036 17:7103609-7103631 GTGCCCATTCACAAAAGTAATGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145786336 17:27596232-27596254 TTGCCCATTCAACAGAGTGAGGG - Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1157291307 18:46411889-46411911 ATGCCCAGTGAGAGGAGGAAGGG + Intronic
1157757019 18:50227891-50227913 TTACCCATAGAGAAGAGTAAGGG - Intronic
1158962852 18:62601011-62601033 ATTTCCATTGAGAAGAGGAAGGG + Intergenic
1161675088 19:5642046-5642068 ATGCCAGTTCAGTAGAATAAGGG + Intronic
1163643933 19:18477657-18477679 ATGCCCAGTGAAAAGAGAAAGGG + Intronic
1163964834 19:20735878-20735900 ATGATCACTCAGAAGACTAATGG - Intronic
1163982790 19:20916987-20917009 ATGACCACTCAGAAGAGTAATGG - Intergenic
1164024280 19:21336529-21336551 GTGCTCATTCAGAAGAACAATGG + Intergenic
1164042091 19:21502033-21502055 ATACCCATTCAGAAGAGTAATGG - Intronic
1164071402 19:21772116-21772138 ATACCCATTAAGAAGAGTACTGG + Intergenic
1164138702 19:22438094-22438116 ATGCCCATTCAGAAGAGTAATGG - Intronic
1164181948 19:22827018-22827040 ATGCCCATTCAGAAGAGTAATGG - Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164218939 19:23175781-23175803 ATGCCCATTCAGAAGTCGAATGG - Intergenic
1164245421 19:23424237-23424259 ATGGCCATTCAGAAGAGTAAGGG - Intergenic
1164308644 19:24027300-24027322 ATGGCCATTCAGAAAAGTAAGGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1167172106 19:47840006-47840028 AAGCAGATTCAGAAGAGAAAGGG - Exonic
1168597950 19:57694270-57694292 ATTTCCAGTCAGAGGAGTAAAGG + Intronic
925241672 2:2336561-2336583 ATGCTCATTTAGAAGAGTTTTGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
931041637 2:58307126-58307148 ATGCCCATCCAGAAAAATAAAGG - Intergenic
931080883 2:58769096-58769118 ATCCCCAATCAGAACACTAACGG + Intergenic
932178035 2:69620531-69620553 AAGAGCATTCAGAAGAGTGATGG - Intronic
932982991 2:76692792-76692814 ATGCTCATTCAGAAATGAAAAGG + Intergenic
933736246 2:85497068-85497090 ATGCCCATTCAGAAGGGTGAAGG - Intergenic
936611782 2:114008706-114008728 ATGGCCATGAAGAAGAGGAAAGG - Intergenic
939665963 2:144951671-144951693 AGTCACATTCAAAAGAGTAAAGG + Intergenic
939988189 2:148852831-148852853 GTGAACAGTCAGAAGAGTAAAGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
940656530 2:156493839-156493861 ATGGCCATTCAGATGAGGGAGGG - Intronic
941641274 2:167991381-167991403 CTGCCCAAAGAGAAGAGTAAAGG + Intronic
942022694 2:171882436-171882458 CTACCCATTCAGCAGAGAAAAGG - Intronic
943364270 2:186954522-186954544 ATGCCCATTCACAAAAGAATGGG + Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
947977116 2:234376301-234376323 ATGCAAATGCAGAAGAATAAAGG - Intergenic
948029551 2:234805811-234805833 AAGCCTAGTCAGAAAAGTAAAGG + Intergenic
1170556417 20:17518615-17518637 AAGCCCTTTCATAAGAGAAATGG + Intronic
1172862947 20:38070418-38070440 AAGCCCATTCAGAAAGGCAAAGG + Intronic
1175378952 20:58549335-58549357 AGGCCCCTGCAGAAGAGCAAAGG - Intergenic
1175409451 20:58756587-58756609 ATTTCCCTTCAGAAGAGAAAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177806755 21:25882681-25882703 ATACTCATTCAGCAGAGTTAAGG - Intronic
1180184199 21:46131430-46131452 ATGGCCAATCAGAAGAGTCAGGG + Intronic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182941108 22:34278348-34278370 TTGCCAGTTGAGAAGAGTAATGG - Intergenic
1183409468 22:37646559-37646581 AAGCCCAGTCAGAAGTGGAAGGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183825668 22:40384915-40384937 ATCCCCATTCAGAATAGGGATGG + Intronic
1185327184 22:50232324-50232346 TTGCCCATTCTGGAGTGTAATGG - Intronic
951567978 3:24030990-24031012 ATCCACATGCAGAAGAATAAAGG - Intergenic
953135474 3:40177933-40177955 ATGGCCATTCAAAAGAGAGAAGG - Intronic
957318549 3:78599659-78599681 ATACACTTTCAGAAGTGTAAAGG + Intronic
957639268 3:82830369-82830391 TTGCCCATTCAGAATGGTATTGG - Intergenic
958701961 3:97603040-97603062 ATTCACATTTAGAAAAGTAATGG - Intronic
960407200 3:117276418-117276440 ATGCACATTCAAGAGAGGAATGG - Intergenic
961583621 3:127903727-127903749 CTGCTCATTCAGAAGGGAAAGGG - Intergenic
963633540 3:147764403-147764425 ATTCCCATTCTGTACAGTAATGG + Intergenic
964282515 3:155081653-155081675 AATCCCATAGAGAAGAGTAAGGG - Intronic
964750954 3:160053569-160053591 ATGCCCAGTCACAAAAGGAATGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965123285 3:164591497-164591519 CTGTCCAGTCAGAAGATTAAAGG + Intergenic
965169947 3:165250120-165250142 ATGCATATTCAGAAAGGTAAAGG + Intergenic
966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG + Intergenic
967514036 3:190346031-190346053 ATGAACATTCAGAAGTGTGATGG + Intronic
967799880 3:193644903-193644925 AAGCCCATTCAGATTAATAATGG - Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG + Intergenic
971819683 4:31535440-31535462 ATTCCTATTCAAAATAGTAATGG - Intergenic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
977442190 4:97082145-97082167 ATTCCCATTCAGCATAGTACTGG - Intergenic
977740183 4:100470596-100470618 AGCACTATTCAGAAGAGTAAAGG + Intronic
978090475 4:104708622-104708644 CTTCCCTTTCAGAAGAGAAAGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979044647 4:115847009-115847031 AAGCCCATTCACAAAAATAAGGG + Intergenic
979597113 4:122546516-122546538 ATTCCCTTTCAGAAGTGCAATGG - Intergenic
979967451 4:127092189-127092211 TTGCCCATTCAGTATAATAATGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981080986 4:140639043-140639065 ATGCCCATTCAAAGGAGTAAAGG - Intronic
981241817 4:142486074-142486096 GTGCCGATTCACAAGAGGAAAGG + Intronic
982876470 4:160657506-160657528 ATGTCACTTCAGAAGAATAAAGG + Intergenic
988005041 5:25399530-25399552 ATGGCCCTTGAGAAGACTAACGG - Intergenic
989413106 5:41142652-41142674 ATGCCCAAACAGGAGAGTCAGGG + Exonic
989505717 5:42225119-42225141 ATGCCTATTCAATATAGTAAAGG - Intergenic
989822806 5:45815852-45815874 AAGGCAATTCAGTAGAGTAAAGG + Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
995489247 5:112673047-112673069 ATGACCATTCAGTGGGGTAAAGG - Intergenic
998482781 5:142476801-142476823 AAGACCATGCAGAAGGGTAAAGG + Intergenic
1002452401 5:179326383-179326405 ATTCCATTTCAGAACAGTAACGG + Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1009856146 6:69266807-69266829 ATGCATATTCAGAAAGGTAAAGG + Intronic
1009933150 6:70200738-70200760 TTGCTCTTTCAGAAGAGGAAGGG - Intronic
1010493662 6:76505333-76505355 TTGCCCATTCAGTATAATAATGG + Intergenic
1011017629 6:82774922-82774944 ATCCCCATTCTGAAGAGGCAGGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1012155184 6:95810721-95810743 ACCCCCATTCAGAATAGTACTGG + Intergenic
1012812623 6:103980267-103980289 ATGTCCATTCGGATGAGAAATGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015828790 6:137345091-137345113 TTGGCAATTCAGAAGAGAAAAGG - Intergenic
1017386442 6:153890225-153890247 ATGCCCACCCAGAAGGGTGAAGG - Intergenic
1018212720 6:161497491-161497513 ATTCCCATTGAAAAGAGTCAAGG + Intronic
1018490000 6:164282565-164282587 ATGTACACTCAGAAGAGTTATGG + Intergenic
1020455113 7:8363650-8363672 AAGGCAATTCAGAAGAATAAAGG + Intergenic
1021569445 7:22049680-22049702 ATGCCAATGCAGAAGAGCATTGG - Intergenic
1025801572 7:64791423-64791445 ATGCTTATTTAGAAGAGTAATGG - Intergenic
1025864612 7:65369271-65369293 ATGCCCATTCAGAGGAGTAATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028356237 7:89913458-89913480 ATGCTCATTCACAAGTTTAATGG + Intergenic
1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG + Intergenic
1029154908 7:98509912-98509934 ATGCCCATTAGGAAGAGGAAGGG - Intergenic
1029335875 7:99898700-99898722 TTGCCCAGTGAGAAGAGTAATGG - Intronic
1030848301 7:114450570-114450592 ATGCACATTCAGAAAAGTTTCGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035848971 8:2895129-2895151 ATGCCTCTTCAGAACAGTATAGG - Intergenic
1037988382 8:23303621-23303643 ATTCCCATTCAGCAGAGGAGAGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1042962490 8:74319437-74319459 ATGCCCATTCAGAACATTTAAGG + Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1045969663 8:108065443-108065465 ATGCCTATTGAGAGGATTAAAGG - Intronic
1046684598 8:117211063-117211085 TTGCCCATTCAGTATAATAATGG - Intergenic
1046703074 8:117422679-117422701 TTGCCCATTCAGTAGAATATTGG - Intergenic
1046906166 8:119575255-119575277 AAGGCCAAGCAGAAGAGTAATGG - Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1051069227 9:13143234-13143256 ATGGCCCTTCTGAAGAGTAAGGG - Intronic
1053097676 9:35342691-35342713 ATGCACATGCAGGAGAGGAATGG - Intronic
1053276789 9:36789232-36789254 TTGCCCAGGCAGAAGTGTAATGG + Intergenic
1053531399 9:38885406-38885428 ATGACTAATCAGAAGATTAAAGG + Intergenic
1054203623 9:62109835-62109857 ATGACTAATCAGAAGATTAAAGG + Intergenic
1054634739 9:67478529-67478551 ATGACTAATCAGAAGATTAAAGG - Intergenic
1054832249 9:69638788-69638810 GTGCCCATTCAGAAGATTGATGG + Intronic
1056098395 9:83277402-83277424 ATGCCCAGGCTGAAGTGTAATGG + Intronic
1056734356 9:89194037-89194059 ATCCACATGCAGAAGAATAAAGG + Intergenic
1057015216 9:91645124-91645146 AGGCACCTCCAGAAGAGTAAGGG + Intronic
1057448835 9:95138334-95138356 ATGCCCCTTGTGAAGAGGAAAGG + Intronic
1058031406 9:100202048-100202070 ACACCCAGTCAGAAGAATAATGG - Intronic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058132764 9:101271504-101271526 ATGCCCATTCCTCAGAGGAAGGG + Intronic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1059442367 9:114315710-114315732 AGCACCATTCAGAAGAATAATGG + Intergenic
1060875679 9:127081951-127081973 ATGGCCATTCAGGAGAGACACGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188269232 X:28117909-28117931 ATCCCCAAGCAGAAGAGAAAAGG - Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1189732470 X:44035876-44035898 ATGGGCTTTCAGAAAAGTAAAGG - Intergenic
1189804035 X:44717783-44717805 CTGCCCATTCACATTAGTAAAGG + Intergenic
1191816966 X:65255941-65255963 AGGCCAATTCATAATAGTAAAGG + Intergenic
1193939521 X:87663512-87663534 ATGCCCATGCAGAAAAGTCTTGG + Intronic
1197312377 X:124920877-124920899 ATGCCCATAAACAACAGTAAGGG - Intronic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198267230 X:135021406-135021428 CTGCAAATTCAGAAGAGAAATGG + Exonic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198584176 X:138101219-138101241 ATTCTCATTCAGAATAGTACAGG + Intergenic
1200423776 Y:3000272-3000294 GTGCACATTCAGAGCAGTAAAGG - Intergenic
1200513605 Y:4112166-4112188 ATGCCCATTCAAATTGGTAATGG + Intergenic
1201524813 Y:14920353-14920375 ATGCCCTTTGAGAAGGGAAAAGG - Intergenic