ID: 1164138905

View in Genome Browser
Species Human (GRCh38)
Location 19:22439960-22439982
Sequence CTGTAAAAAAGCAGAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 1, 2: 10, 3: 31, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164138905 Original CRISPR CTGTAAAAAAGCAGAACTGT GGG (reversed) Intronic
900130995 1:1087205-1087227 CTGTGGGATAGCAGAACTGTGGG + Intronic
902234679 1:15049721-15049743 CTGTATAAAATCAGAACTATAGG + Intronic
902901900 1:19523182-19523204 CTGTAAAAGAGCAAATCAGTGGG + Intergenic
903940775 1:26929720-26929742 CTGTTTAAAAACATAACTGTAGG + Intronic
904463681 1:30695207-30695229 CTGGAAAAAGGCTGAACAGTGGG + Intergenic
905545319 1:38793297-38793319 CTTTGAAAAATCAGAACTTTTGG - Intergenic
906200912 1:43959729-43959751 ATGTAAAGAAGCAGCTCTGTGGG - Intronic
909864675 1:80653198-80653220 ATATAAAAAAGCAAAAATGTTGG - Intergenic
910228829 1:84965303-84965325 CTGAATAAATGCAGATCTGTGGG - Intronic
911174916 1:94809111-94809133 CTGCACAAATGCAGAAATGTAGG + Intergenic
912406101 1:109438854-109438876 GTGTGAAAAAGTAGATCTGTCGG + Intergenic
914829469 1:151160143-151160165 CTGAGAAAAAGCAGCACTGTAGG - Exonic
915025630 1:152827060-152827082 TTTTTAAAAAGCAGAACTGCAGG + Intergenic
915099744 1:153490787-153490809 CTATGAAACAGCAGCACTGTGGG - Intergenic
915281597 1:154826354-154826376 CTGTAATAAAGCACATCTATAGG + Intronic
916633887 1:166647265-166647287 TTCTAATAAAGCAGAACTGGAGG + Intergenic
917178892 1:172270816-172270838 CTGAAAAAAAAAAGTACTGTGGG + Intronic
917607712 1:176651970-176651992 TTTTAAAAAAACAGAAATGTTGG - Intronic
918183883 1:182110383-182110405 CTGTAAAAAAGTAGAAATTTAGG + Intergenic
919469023 1:197955924-197955946 CTATCAGAAAGCAGAGCTGTGGG + Intergenic
920984420 1:210872359-210872381 CTGTTTAAAAGCAGAAGTGAAGG - Intronic
921412201 1:214847823-214847845 CTGGAAAACAGCAGCACTGACGG + Intergenic
921485154 1:215706349-215706371 CTCCCAAAAAGCAGAACAGTAGG - Intronic
921790677 1:219286844-219286866 CTGTCAAAAAGCAGAGATGATGG - Intergenic
921870331 1:220132781-220132803 CTGTAAAATCCCAGAACTTTGGG - Intronic
922378560 1:224996651-224996673 CTGTAATCAAGCAGAACTGCTGG + Intronic
1064062851 10:12153274-12153296 CTGTAAAGAAACAAAACTGAAGG - Intronic
1064313044 10:14228835-14228857 CTGTTCAAAAGCAGAATTCTAGG + Intronic
1064903740 10:20321678-20321700 CTGGGAAAGAGCAGAACAGTGGG + Intergenic
1065735353 10:28746326-28746348 CTGTAAGAAACCATAACCGTGGG + Intergenic
1066976263 10:42370656-42370678 CTGTGAAATAGCAGAACTGTGGG + Intergenic
1067732636 10:48823056-48823078 CTGTACAAATGCATACCTGTAGG + Intronic
1068056912 10:52022881-52022903 CTATAAAAATGCAGAACTTTTGG + Intronic
1068177714 10:53483639-53483661 CTGGAAAATAGCAAAACAGTGGG + Intergenic
1068396053 10:56463642-56463664 CTGAAAAAAAGAAGAAAGGTTGG + Intergenic
1068471046 10:57463916-57463938 CTTTAAAAGAACAGAACTATAGG - Intergenic
1069531247 10:69221146-69221168 ATCTAAAAAAAAAGAACTGTTGG + Intronic
1072520874 10:96228932-96228954 CTTTAAAAAAAAAGAATTGTAGG + Intronic
1074021714 10:109591398-109591420 CTGTAAAGAGGCAGAATTGCTGG - Intergenic
1074591191 10:114814994-114815016 CAGGAAAAAAGCAAAAATGTGGG - Intergenic
1075279164 10:121124604-121124626 CAGTAAAAAACCAGAAATGCAGG + Intergenic
1077983224 11:7322561-7322583 CTGTAGAACAGCACAACTGAAGG + Intronic
1078490633 11:11764988-11765010 CTGTACAAAAGAAGAAATGGAGG - Intergenic
1079280254 11:19080852-19080874 CTGTACAAAACAAGGACTGTAGG + Intergenic
1083142485 11:60733492-60733514 CTGTGAGAGAGCAGAACTGCGGG - Intronic
1084802519 11:71554425-71554447 CTGTAAAAAAGCAGAAAAACAGG - Intronic
1085741087 11:79079093-79079115 CTGTACAGAAAGAGAACTGTCGG + Intronic
1085875016 11:80395951-80395973 TTATATAAAAGCAGATCTGTAGG + Intergenic
1086839524 11:91667555-91667577 CTGTAAAACAGCAACAATGTCGG - Intergenic
1086954602 11:92923176-92923198 CTGTGAAAAAGAAGAAATGATGG + Intergenic
1087990182 11:104739864-104739886 CAAGAAAAAAGCAGCACTGTTGG + Intergenic
1095994325 12:48066950-48066972 CTGGAAGAAAGTAGAACTATGGG + Exonic
1096501571 12:52067068-52067090 CTGAAAAAGGGCAGAACTGTGGG + Intergenic
1098452921 12:70640534-70640556 CTGTATAAAAGCATCACTATCGG + Intronic
1098609656 12:72440209-72440231 CTGCAAAAAAAGAAAACTGTAGG - Intronic
1099799124 12:87434901-87434923 CTGGAAAATAGCAGAACAGTGGG - Intergenic
1099875127 12:88394251-88394273 TTTTAAAAAAACAGAACTTTGGG + Intergenic
1100760530 12:97801866-97801888 CTGTAATAAAGGGAAACTGTAGG + Intergenic
1105074135 12:133260502-133260524 CTGTACAATAGCAGAACAGAGGG - Intergenic
1105212474 13:18265202-18265224 CTGTAGAAAAACAGACCTGGAGG - Intergenic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1105686405 13:22786650-22786672 ATCTCAAAAAGCAGACCTGTTGG - Intergenic
1106003726 13:25749468-25749490 CTGGAGAAAAGCAGAGCAGTGGG + Intronic
1106122577 13:26872886-26872908 AAGTAAAAAAGCAGAGCTGTTGG - Intergenic
1107079052 13:36354695-36354717 CTGTAATAAACCAGAACTGTGGG + Intronic
1110112019 13:71759591-71759613 ATGTAAAAAAGCAGGACAGCTGG + Intronic
1111281824 13:86036340-86036362 CTGTGAAAAAGCTGAAATGCTGG + Intergenic
1111428051 13:88115519-88115541 TTTTAAAAAAGCACAAATGTTGG + Intergenic
1111732328 13:92091918-92091940 AAGTAAAAAAGCAAATCTGTTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114164750 14:20209566-20209588 AAGTAAAAAAGTAGAACTGGAGG - Intergenic
1116503914 14:45654567-45654589 CTGTAAGAGAGCAGAAGAGTAGG - Intergenic
1117529639 14:56647220-56647242 CTAGAAAACAGCAGAAATGTTGG - Intronic
1117600295 14:57367161-57367183 ATGTAAAAAAGGAGAACATTGGG + Intergenic
1117962304 14:61175484-61175506 CTGCAAAAAATCAAAAATGTTGG - Intergenic
1118017733 14:61676779-61676801 CAGTTAAAAAGCAGCTCTGTAGG - Intergenic
1120609839 14:86625710-86625732 CAGAAGAAAAGGAGAACTGTAGG - Intergenic
1120649927 14:87119716-87119738 CTGGAAAATAGCAGAACAGTGGG - Intergenic
1120707057 14:87756062-87756084 CTTTAAAAATGGAGAACTGGAGG + Intergenic
1121596209 14:95165060-95165082 CTGAAAAAAAGCAGAGCTATAGG + Intergenic
1122728466 14:103776991-103777013 CTCAAAAAAAGCCGAAATGTTGG - Intronic
1202843704 14_GL000009v2_random:147541-147563 ATGTAAAAAAGGAAAACTTTGGG - Intergenic
1202879544 14_KI270722v1_random:44899-44921 ATGTAAAAAAGGAAAACTTTGGG + Intergenic
1123671033 15:22657416-22657438 AAGTAAAAAAGCAAACCTGTTGG - Intergenic
1124258736 15:28167314-28167336 CTGTCAAAACGAAGAACTGAAGG + Intronic
1124526971 15:30463750-30463772 AAGTAAAAAAGCAAATCTGTTGG - Intergenic
1124706827 15:31973502-31973524 CTGAAAACAAGCAGAACTTCTGG - Intergenic
1124771682 15:32543933-32543955 AAGTAAAAAAGCAAATCTGTTGG + Intergenic
1125289405 15:38129525-38129547 CTGTAAAAATGCTCAAATGTGGG + Intergenic
1126531242 15:49713342-49713364 CCAGAAATAAGCAGAACTGTGGG + Intergenic
1127052127 15:55095572-55095594 CTTAAAAAAAGCAAAACTTTGGG + Intergenic
1127832751 15:62765163-62765185 CTGTAATAAGACAGCACTGTTGG + Intronic
1129306351 15:74666631-74666653 CTGGAAAAATGCAAAACTGCAGG + Intronic
1129496344 15:75985238-75985260 CTGTAATAAATCATTACTGTGGG - Intronic
1129704485 15:77786522-77786544 GTGTAAATATCCAGAACTGTAGG - Intronic
1130601050 15:85273580-85273602 CTGAAAAAAATAAGCACTGTAGG + Intergenic
1130817449 15:87452890-87452912 CTAGAAAAAAGCAGTAATGTGGG + Intergenic
1132462454 16:62189-62211 CAGTAAAAAAGCAACACTGCGGG + Intronic
1133235555 16:4385884-4385906 CTGTAAAACAGAAGAACTCGAGG + Intronic
1133637654 16:7684743-7684765 CTCTAACAAAGCAGAAATGGTGG - Intronic
1134910391 16:18020623-18020645 CTGTAAAACAGCAGTACCGCTGG + Intergenic
1136468667 16:30463491-30463513 TTCTGAAAAAGCAAAACTGTAGG + Intergenic
1137429736 16:48408864-48408886 CTGGAAGAATGCAGAAGTGTTGG + Intronic
1139242352 16:65406153-65406175 TTGTAAGAAACCAGAACTATTGG + Intergenic
1140836902 16:78803140-78803162 GTGGAATAAATCAGAACTGTTGG - Intronic
1144426764 17:15150421-15150443 CTGGGAAATAGCAGAACAGTGGG - Intergenic
1146369437 17:32256158-32256180 GTCTAAAGAAGCAGAGCTGTGGG + Intergenic
1146417876 17:32653750-32653772 CTGTAATAAAACATAACAGTAGG - Intronic
1149282747 17:55126432-55126454 TTTTAAAAAATCAGAACAGTTGG + Intronic
1150152278 17:62819862-62819884 CTGTAAAAAAGAAGACGTGAAGG + Intergenic
1150462442 17:65363961-65363983 CTGGAAAAAGGCAAAACTATAGG - Intergenic
1150810547 17:68353419-68353441 TTGTTAAAAAGCAGACCTGGGGG - Intronic
1153330999 18:3874506-3874528 CTTTTAAAAAGCAGAATTCTTGG - Intronic
1153630140 18:7061730-7061752 CCATAAAAAAGCAAAACTGGAGG + Intronic
1154342540 18:13516150-13516172 GTGTAAGAAAAAAGAACTGTAGG + Intronic
1155013779 18:21811348-21811370 ATATTCAAAAGCAGAACTGTTGG - Intronic
1155680200 18:28478179-28478201 CTGTAAAAAAGAAGAAAAATGGG + Intergenic
1155929602 18:31691876-31691898 CTGTAAAAAATAAGAAGTTTAGG + Intergenic
1156923485 18:42551766-42551788 TTCTAAAAAACCAAAACTGTTGG + Intergenic
1158227882 18:55219261-55219283 CTGTAAAGAAGTAGACTTGTAGG - Intergenic
1159247879 18:65833504-65833526 CTGTAAAAAGGCATAAATTTTGG + Intronic
1159294998 18:66473692-66473714 CGGTAAAACAGCAGAGCTCTCGG - Intergenic
1163748848 19:19063728-19063750 CAGAAAACAGGCAGAACTGTCGG - Intergenic
1163951688 19:20593961-20593983 CTATAAAATAGCAGAACTGTGGG + Intronic
1163964935 19:20737134-20737156 CTGTAAAATAGCAGAACTGTGGG - Intronic
1163982899 19:20918286-20918308 CTGTAAAATAGTAGAACTGTGGG - Intergenic
1164035156 19:21447522-21447544 CTGTGAAATAGCAGAACTGTGGG - Intronic
1164042153 19:21502963-21502985 CTGTGAAACAGCAGAACTGTGGG - Intronic
1164071287 19:21770842-21770864 CTATGAAATAGCAGAACTGTGGG + Intergenic
1164122631 19:22281793-22281815 CTGTGAAATAGCAGAACTGTGGG - Intergenic
1164138905 19:22439960-22439982 CTGTAAAAAAGCAGAACTGTGGG - Intronic
1164177458 19:22788107-22788129 CTGTGAAATAGCAGAACTGTGGG + Intergenic
1164212672 19:23113767-23113789 CTGTGAAATAGCAGAACTATGGG - Intronic
1164219008 19:23176729-23176751 CTGTGAAATACCAGAACTGTGGG - Intergenic
1164308365 19:24024945-24024967 CTGTGAAATATCAGAACTGTGGG + Intergenic
1164792796 19:31002483-31002505 CTGGAAAAGGGCAGAACTGGGGG - Intergenic
1168032015 19:53687863-53687885 CTGTAAAAAAATACAAATGTAGG - Intergenic
1168587156 19:57602889-57602911 CTCAAAAAAAGAAGAACTGATGG - Intronic
1202655163 1_KI270708v1_random:13905-13927 ATGTAAAAAAGGAAAACTTTGGG + Intergenic
926017997 2:9471320-9471342 CTGAAAATAAGCAGAAATGCAGG - Intronic
928049568 2:27976495-27976517 CTGGAAAAATGCAAAACTGAAGG + Intronic
929833445 2:45370881-45370903 CTAGAAAAGAGAAGAACTGTAGG + Intergenic
929903368 2:46025073-46025095 CTGTAAAAAAAAACAAATGTAGG + Intronic
930358971 2:50354418-50354440 CTGTAAAAAAGGTTAATTGTAGG + Intronic
932117146 2:69062254-69062276 TTGGAAAAATGCAGAAATGTGGG - Intronic
932249331 2:70228590-70228612 CTTTAAAAATGCAAAATTGTTGG + Intronic
932410480 2:71544059-71544081 GTGGAACAAAGCAGAACTGCCGG - Intronic
932531990 2:72544912-72544934 CTGTAAAAATGCAAAATTCTAGG - Intronic
933026522 2:77266735-77266757 CTGCAAATCAACAGAACTGTTGG + Intronic
933746436 2:85575167-85575189 CTATAAAAAAATAAAACTGTTGG - Intronic
934301151 2:91777200-91777222 CTGTAGAAAAACAGACCTGGAGG + Intergenic
937433940 2:121864555-121864577 TTGCAAGAAAGCAAAACTGTTGG - Intergenic
939420235 2:141957644-141957666 CTGTAAAAAACAAGAACTGGAGG - Intronic
939706599 2:145461575-145461597 CTTTACAAAAACAGACCTGTAGG - Intergenic
939856550 2:147365656-147365678 CTGACAAAAAGCAATACTGTAGG - Intergenic
940010006 2:149042457-149042479 CTGGAAGAAAGCAGAAGTGGAGG + Intronic
940053292 2:149486816-149486838 CTGTCAGCAAGTAGAACTGTAGG + Intergenic
941037396 2:160583388-160583410 ATGGAAAATAGCAGAAATGTTGG - Intergenic
941214767 2:162692666-162692688 CAGGAAAAAAGCAGTACTTTAGG + Intronic
941441592 2:165544522-165544544 CTGTAAAAGAGAAAAAATGTAGG + Intronic
942135127 2:172917714-172917736 ATGTTAAAAAGCAGAAATGCTGG - Intronic
942717603 2:178911334-178911356 CTGTAAAATAGAAGTACTATTGG - Intronic
942999756 2:182311527-182311549 TTTTAGAAAAGCAAAACTGTAGG - Intronic
943625234 2:190190976-190190998 CTGGAAAAAGGCAAAACTATAGG - Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943703611 2:191012771-191012793 CTGGAGCAAAGCAGAAATGTTGG - Intronic
943731420 2:191306947-191306969 CAGTAAACAAACTGAACTGTTGG - Intronic
944957464 2:204828890-204828912 CTGTAAGGAAGCTGATCTGTGGG - Intronic
1169831028 20:9825100-9825122 CTGTAAAACAGAAGAACATTTGG - Intronic
1170146834 20:13184724-13184746 ATGGCAAAAAGCAGAAGTGTGGG - Intergenic
1170469130 20:16650765-16650787 CTGTTGAAAACCAGAAATGTGGG - Intergenic
1173575253 20:44109140-44109162 CTGTAAAAGAGCACAGCTCTGGG + Intergenic
1175409396 20:58756155-58756177 CAGTCAAAAGGCAGGACTGTTGG + Intergenic
1176632457 21:9152455-9152477 ATGTAAAAAAGGAAAACTTTGGG - Intergenic
1176640848 21:9302360-9302382 ATGTAAAAAAGGAAAACTTTGGG + Intergenic
1176921050 21:14687829-14687851 CTGTAGGAATGCATAACTGTAGG + Intergenic
1177285673 21:19045842-19045864 GTGTAAAAAAGAATAACTCTAGG - Intergenic
1178677007 21:34639475-34639497 CTGTAACAAAACAGCACTGTGGG - Intergenic
1180131093 21:45827695-45827717 CTGTTAATAAGCAGAACTCAGGG + Intronic
1180349874 22:11791742-11791764 ATGTAAAAAAGGAAAACTTTGGG + Intergenic
1180388334 22:12200510-12200532 ATGTAAAAAAGGAAAACTTTGGG - Intergenic
1180815288 22:18785521-18785543 CTGTAGAAAAACAGACCTGGAGG - Intergenic
1181201478 22:21219858-21219880 CTGTAGAAAAACAGACCTGGAGG - Intronic
1181782053 22:25200655-25200677 CTGTAGCAATGAAGAACTGTCGG + Intronic
1182466944 22:30523037-30523059 CTGGAAAAAATCAAAAGTGTAGG + Exonic
1184364692 22:44042809-44042831 CTGTAACAAAGCAGGGCTCTAGG - Intronic
1203225436 22_KI270731v1_random:75572-75594 CTGTAGAAAAACAGACCTGGAGG + Intergenic
1203265394 22_KI270734v1_random:11212-11234 CTGTAGAAAAACAGACCTGGAGG - Intergenic
951681320 3:25297831-25297853 CTCTAAAAAAGTAGAAATCTAGG - Intronic
952131282 3:30366312-30366334 TTGTAAAAATGAAGAACTTTTGG + Intergenic
952258703 3:31717966-31717988 CTGTTAATAATCAGAACGGTGGG + Intronic
952602170 3:35097282-35097304 CTGTAATAAAGCATTTCTGTAGG - Intergenic
952638507 3:35561817-35561839 GTGTAAAGAAGCACAACTGATGG - Intergenic
953231166 3:41066237-41066259 CTGTAGAAAAGTAGAACACTTGG + Intergenic
955533021 3:59894005-59894027 CTGTAAAATACCAGCACTTTGGG + Intronic
957887809 3:86312946-86312968 CTCTAAAAAAGCAAAACTCTTGG + Intergenic
958965930 3:100558250-100558272 CTCCAAAAATGCAGTACTGTGGG + Intronic
959264922 3:104125061-104125083 CTGTACAAAAGCATAACTTTGGG - Intergenic
960977075 3:123185911-123185933 CTCTAAAAAAGCAAAACAGTGGG - Intronic
962300055 3:134231780-134231802 TTGTAAAGAAACAGAACTTTGGG - Intronic
962876150 3:139537624-139537646 CTGGCAGAAAGCAGGACTGTGGG + Intronic
963271573 3:143290648-143290670 CTGAAATAAAGCAGAAGAGTGGG + Intronic
963775252 3:149432656-149432678 CTGCTAAACAGCAGAACTATTGG - Intergenic
964139993 3:153386738-153386760 CTTTCAAAAAGCAAAAATGTTGG - Intergenic
964429238 3:156587358-156587380 ATGAAAATAAGCAGAAGTGTGGG - Intergenic
1202746045 3_GL000221v1_random:102663-102685 ATGTAAAAAAGGAAAACTTTGGG - Intergenic
968571311 4:1342926-1342948 TTCTGAAAAAGCAGAACTGGAGG - Intergenic
970632074 4:17958232-17958254 CAGGAAAAAAACAGAATTGTGGG + Intronic
970687352 4:18583720-18583742 CTGTAAAAACACACAACTCTAGG - Intergenic
971962934 4:33512280-33512302 CTGGAAAATAGCAGAACAGTGGG - Intergenic
971991694 4:33906309-33906331 ATGAAAAAAAAAAGAACTGTGGG + Intergenic
972329731 4:38054016-38054038 CTGTAAGAAAGCAGTTCTTTAGG + Intronic
972602860 4:40587980-40588002 CTGACAAAAAGAAGAAATGTAGG - Intronic
975948882 4:79743726-79743748 CTCTACCAAAGCAGAACTGTTGG + Intergenic
977063080 4:92279922-92279944 CTGTATTAAAACAGAACTTTAGG + Intergenic
977133844 4:93276386-93276408 CTGAAAAAGAGCAAAACTGGAGG - Intronic
980814328 4:137923345-137923367 CTGACAAATAGCAGAACAGTGGG - Intergenic
981835637 4:149050177-149050199 CTTTAAAAAAGAAGAATTGGTGG - Intergenic
982760041 4:159271140-159271162 CTTTAAAAAAACACAACAGTTGG - Intronic
983274413 4:165600164-165600186 CTGTAAAAACGCTGGTCTGTAGG - Intergenic
983291174 4:165808096-165808118 CTACAAAAACACAGAACTGTTGG - Intergenic
984521242 4:180803702-180803724 ATGTAAAACAGCACAAGTGTGGG + Intergenic
984777824 4:183498822-183498844 CTGTAAAAAAGCTGGTCTGTAGG + Intergenic
985235367 4:187867304-187867326 CTGTAAAAAAGTGGATCTATTGG - Intergenic
985500837 5:244015-244037 ATGTAAAAAAGGAAAACTTTGGG + Intronic
987184615 5:15403241-15403263 CTGTTAAAAACAAAAACTGTAGG - Intergenic
987654775 5:20793098-20793120 ATGTGAAAAGGCAGAACTCTTGG - Intergenic
987896041 5:23948639-23948661 CTAAAAAATAGCAGAAATGTTGG - Intergenic
988740867 5:34068802-34068824 ATGTGAAAAGGCAGAACTCTTGG + Intronic
988999695 5:36747290-36747312 CAGTAAAAAAGCAGAACAAAAGG + Intergenic
989758751 5:44987436-44987458 ATGTAAAAAAGGAAAACTTTGGG + Intergenic
990351093 5:54917406-54917428 CTGTAAAAAACCAAAACTAGGGG - Intergenic
990984423 5:61627692-61627714 CTTTAAAAATGCAGAACAGTTGG - Intergenic
991220177 5:64205172-64205194 CATTACAAAAGCAGAACTGATGG - Intronic
993378287 5:87176043-87176065 ATGTAAAATAGCTGAACAGTGGG - Intergenic
993556520 5:89346363-89346385 CTGTAAAAAAGCAGAAAGGGAGG + Intergenic
993968813 5:94391362-94391384 CTGTATAAATGCAGAACAGCCGG + Intronic
994124998 5:96159030-96159052 CTGGAAAAAGGCAGAAGTCTAGG + Intergenic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
994856339 5:105125425-105125447 CTGAAAACAAACATAACTGTTGG - Intergenic
996623989 5:125547287-125547309 ATTTATAAAAGCAGAAATGTGGG - Intergenic
998300208 5:141010634-141010656 CTGTTAAAACACTGAACTGTTGG - Exonic
998326382 5:141284232-141284254 AGATAAAAAAGTAGAACTGTGGG + Intergenic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
998807454 5:145932821-145932843 CTGTTATAAAGGAGAAGTGTAGG + Intergenic
1000175119 5:158744575-158744597 CTGAAGAAAACCAGAACTTTAGG - Intronic
1001316797 5:170648550-170648572 ATGGAAAAAAGCAAAACTATGGG + Intronic
1001852783 5:174984123-174984145 TTGTAAAGAAGCAGCATTGTAGG - Intergenic
1002047774 5:176551639-176551661 CTTTAAAAAATGAGAACTATTGG + Intronic
1002671939 5:180874527-180874549 CTGGGCAATAGCAGAACTGTGGG - Intergenic
1004204586 6:13580495-13580517 TTTTAAAAAGGCAAAACTGTTGG - Intronic
1004741962 6:18471039-18471061 CTAAAAAAAAGCAAAACTGAGGG - Intergenic
1004788687 6:18998943-18998965 GAGGAAGAAAGCAGAACTGTGGG - Intergenic
1005753193 6:28902767-28902789 CTCAAAAAAAAAAGAACTGTAGG + Intergenic
1005773227 6:29098669-29098691 CTGCTAAAAAGCAGATCTTTTGG + Intergenic
1005779212 6:29170862-29170884 CTGCTAAAAAGCAGATCTTTTGG + Intergenic
1005842495 6:29752825-29752847 CTATGAAAATGCAGACCTGTGGG + Intergenic
1006563341 6:34932679-34932701 CAATAAAAAAGAAGAACTGCTGG - Intronic
1006832727 6:36978339-36978361 CTGTGGGAAAGCAGAACTGTGGG + Intronic
1009314999 6:62207995-62208017 CTATAAAATAGCAGATGTGTAGG - Intronic
1009672130 6:66768893-66768915 CAGTAAAATACCAGAAATGTAGG - Intergenic
1009876671 6:69514494-69514516 GTGGAAAAAAACAAAACTGTTGG + Intergenic
1010669551 6:78671802-78671824 CTGCAAAAATGTAGAACTGGAGG + Intergenic
1010688627 6:78881307-78881329 CTGGAGAAAAGCAAAACTATGGG + Intronic
1012277629 6:97293087-97293109 CTGTGAGAAAACAGAACTGATGG - Intergenic
1012331772 6:97999430-97999452 TTATAAAAAAGCAGGACTCTGGG - Intergenic
1012938277 6:105390903-105390925 GTGTAAAAAAGCAGGGCTGAAGG + Intronic
1013065364 6:106679184-106679206 CTATATAAAAACAGATCTGTTGG + Intergenic
1013677860 6:112487074-112487096 CTGTAAAAAACAAGAAATGATGG - Intergenic
1015230113 6:130905275-130905297 CTTTAAAAAAGTAAAACTATGGG + Intronic
1015831247 6:137371282-137371304 CTGGGAAATAGCAGAACAGTAGG + Intergenic
1017047235 6:150358368-150358390 CTGTAATAAATCACAACTGTTGG - Intergenic
1018563800 6:165130172-165130194 TTTTAAAAAAGCAGTACAGTTGG + Intergenic
1019063790 6:169278047-169278069 CTGGGAAATAGCAGAACAGTGGG - Intergenic
1019855090 7:3597428-3597450 CTGGGAAATAGCAGAACAGTGGG + Intronic
1021265610 7:18517480-18517502 CTGTAAAAGAGGAGAAATGGAGG - Intronic
1022059187 7:26773982-26774004 CTGTAAAAAAGTTGGAGTGTAGG - Intronic
1022089966 7:27101789-27101811 CTGTCAAAAAGCCAAACTCTAGG + Intronic
1023648064 7:42340138-42340160 CTGTAAAATAGCAGATTTCTGGG - Intergenic
1024113527 7:46171206-46171228 CTGTAAAACAGCAGAATTATAGG + Intergenic
1024249394 7:47494959-47494981 CTGAAAAAAAGAAGAAATGGGGG + Intronic
1024908435 7:54416785-54416807 ATCTAAAAAAGCAGAACTCATGG + Intergenic
1025864691 7:65370220-65370242 CTGTGAAGTAACAGAACTGTGGG - Intergenic
1027978904 7:85191727-85191749 CTTGAACAAAGCAGAAGTGTTGG - Intergenic
1028818156 7:95173273-95173295 CTCTAAAAGAGGAGAACTGGAGG + Intronic
1029035471 7:97515798-97515820 CTATAAAAATGCAGAATTATAGG - Intergenic
1030130279 7:106193902-106193924 CAGCCAAAAAGTAGAACTGTTGG + Intergenic
1030418228 7:109272084-109272106 CAGTAAAATGGCAGAACCGTAGG - Intergenic
1030825321 7:114148979-114149001 CTGTATAAAAGCAGAAGTAAGGG - Intronic
1030992831 7:116321093-116321115 CTGAAAAAAAGCAAAACTATAGG + Intronic
1032385730 7:131521979-131522001 CTGAAGCAAAGCAGAGCTGTGGG + Intronic
1033962958 7:146936419-146936441 CTGGAAAACAGTAGAACAGTGGG - Intronic
1037018368 8:13936976-13936998 CTCTAAAAAAGGAGAAGTGCCGG + Intergenic
1037323261 8:17663900-17663922 CTTTAAAAATGAAGAAATGTAGG - Intronic
1039603061 8:38858010-38858032 CTATAAAATACCAGAACTTTGGG + Intergenic
1040805151 8:51387038-51387060 CTGTGAAAGAGTAGAACAGTGGG - Intronic
1040974793 8:53178060-53178082 CTGAAGAAAAGCAGAGATGTGGG + Intergenic
1041791532 8:61701099-61701121 GAGAAAAAAAGCAGAACAGTGGG - Intronic
1041868093 8:62599630-62599652 CTGTAAAAGGGAAGAATTGTAGG + Intronic
1044216100 8:89612610-89612632 CTTTAAAAAAACAGAACATTCGG - Intergenic
1044853421 8:96451426-96451448 CTTAAAAAAAGGAGAACTTTAGG + Intergenic
1044966714 8:97580885-97580907 CTGCAAAAAAGAAAAATTGTAGG + Intergenic
1045174202 8:99703868-99703890 CTGTGAAATAGCTGAACTTTAGG + Intronic
1045596834 8:103666478-103666500 CTAGAAAATAGCAGAACAGTGGG + Intronic
1045944019 8:107774760-107774782 CTGTTAAAAAACAAATCTGTAGG - Intergenic
1051026753 9:12622317-12622339 TTTTTAAATAGCAGAACTGTTGG + Intergenic
1053508145 9:38663391-38663413 CTGTAAAAGAGCAGAACTGCAGG + Intergenic
1055546652 9:77381517-77381539 CAGTAACAAAAAAGAACTGTTGG + Intronic
1055654699 9:78440623-78440645 CTGGAGAAAAGCAGAACAATAGG + Intergenic
1056197082 9:84239201-84239223 CTGAACAAACACAGAACTGTAGG + Intergenic
1057449257 9:95142294-95142316 CTCTAAAAAATAAAAACTGTTGG - Intronic
1058218147 9:102260680-102260702 CTGGAAAATAGCAAAACAGTGGG - Intergenic
1058789056 9:108423312-108423334 CTGTAAAAAAGCACAACTCCTGG + Intergenic
1061441541 9:130607510-130607532 CTGTAAAAAAGGAAAAATGCTGG - Intronic
1203755289 Un_GL000218v1:120079-120101 ATGTAAAAAAGGAAAACTTTGGG - Intergenic
1203714667 Un_KI270742v1:132621-132643 ATGTAAAAAAGGAAAACTTTGGG - Intergenic
1186304713 X:8243481-8243503 CTGTTCAAAAGAAGAACTATAGG - Intergenic
1188039890 X:25359444-25359466 CTTAAAAAAAACAGAAGTGTGGG - Intergenic
1188157051 X:26753059-26753081 CTGGGAAATAGCAGAACAGTGGG + Intergenic
1189001709 X:36954929-36954951 CTGGGAAATAGCAGAACTGCGGG - Intergenic
1189903245 X:45730156-45730178 CTTTAAAAAGGCAAAACTGATGG + Intergenic
1191789728 X:64956861-64956883 CTGGAAAACAGTAGAACAGTGGG - Intronic
1192727006 X:73764187-73764209 TTTTAAAAAATCAGAACTTTTGG - Intergenic
1193695628 X:84704273-84704295 CTGGGAAATAGCAGAACAGTGGG + Intergenic
1193958667 X:87895965-87895987 CTGGGAAACAGCAGAACAGTAGG + Intergenic
1194138039 X:90172492-90172514 CTGGAAAATAGCAGAACAGCAGG + Intergenic
1195267242 X:103194393-103194415 CTGTAAAAAATAACAAGTGTTGG + Intergenic
1195471770 X:105238443-105238465 CTGAAAAATAGCAGAACAGTGGG + Intronic
1196631510 X:117945434-117945456 CTGTAACACCACAGAACTGTGGG + Exonic
1197698583 X:129577797-129577819 ATGAAAAACAGCAGAACGGTAGG - Intronic
1199541474 X:148962692-148962714 CTGTGAAAAACAAGAAGTGTAGG - Intronic
1199905292 X:152222272-152222294 ATAGAAAAAAGCAGAACTGAAGG - Intronic
1200483832 Y:3742746-3742768 CTGGAAAATAGCAGAACAGCAGG + Intergenic
1201168906 Y:11237688-11237710 ATGTAAAAAAGGAAAACTTTGGG - Intergenic
1201789171 Y:17818902-17818924 CTGTAAAAAAGCATTAATTTTGG - Intergenic
1201812382 Y:18087085-18087107 CTGTAAAAAAGCATTAATTTTGG + Intergenic
1201925704 Y:19285254-19285276 CTGTAAAATTGCAGAACTGTGGG - Intergenic