ID: 1164139789

View in Genome Browser
Species Human (GRCh38)
Location 19:22448824-22448846
Sequence CTGCGTCAGTGGCAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 5, 3: 14, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164139784_1164139789 4 Left 1164139784 19:22448797-22448819 CCAGTGACAAGCTTTATGTTGTG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1164139789 19:22448824-22448846 CTGCGTCAGTGGCAGATGGTAGG 0: 1
1: 1
2: 5
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164139789 Original CRISPR CTGCGTCAGTGGCAGATGGT AGG Intronic
900393094 1:2442336-2442358 CTACGCCAGGGCCAGATGGTGGG + Intronic
900529909 1:3148096-3148118 CCGCCTCAGTTGCAGGTGGTGGG + Intronic
901087952 1:6623153-6623175 GTGCTTCAGTGGGAGAAGGTGGG - Exonic
907870897 1:58441847-58441869 CTGAGTCGGTAACAGATGGTTGG + Intronic
910239249 1:85068769-85068791 CTGCCTGATTGGCAGAAGGTGGG - Intronic
913177402 1:116287500-116287522 CTGAGTTAGTGGCTGCTGGTAGG - Intergenic
913264474 1:117031071-117031093 ATGGGTGAGAGGCAGATGGTGGG + Intronic
915065545 1:153221403-153221425 CTGCGACAGTGCCAGGAGGTGGG + Intergenic
916863710 1:168833823-168833845 CTGCCTCAGTGGCAGGGGGCAGG - Intergenic
921052064 1:211517850-211517872 CTGAGCCAGTGGGAGAAGGTGGG + Intergenic
922239012 1:223743303-223743325 CTGAGTCAGAGGCAGAAGGCTGG - Intronic
924581665 1:245329314-245329336 TTGTGTTAGTGGCAGATGATGGG - Intronic
1063899085 10:10713201-10713223 CTGCTTCTGTGACAGAAGGTGGG - Intergenic
1064855805 10:19766202-19766224 TTGCCTCAGTAGCAGGTGGTTGG + Intronic
1065877198 10:30007745-30007767 CTGGGGCAGGGGCAGCTGGTGGG - Intergenic
1068189026 10:53625895-53625917 TTCAGTCAGTGGCAGAAGGTTGG - Intergenic
1069777543 10:70935735-70935757 CTGCGGGATTGGCAGAGGGTTGG + Intergenic
1069820963 10:71228456-71228478 CTTCGTCTGTGGCATATGTTAGG - Intronic
1072307794 10:94124078-94124100 CTTCTTCAGTGGCAGATGGAGGG - Intronic
1074911259 10:117911443-117911465 CTGGGTCAGTGCCAGGAGGTGGG - Intergenic
1076531278 10:131146958-131146980 CTGAGGCAGTGACAGCTGGTGGG - Intronic
1083181188 11:60986737-60986759 CTGCCTCCGGGGCAGAAGGTGGG - Intronic
1083721185 11:64604329-64604351 CTGAGTCAATGGCTGAGGGTAGG + Intergenic
1084216424 11:67649102-67649124 CTGAGTCCTTGGCAGGTGGTGGG + Intronic
1084257143 11:67950883-67950905 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1085580517 11:77645943-77645965 CTGCATCAGTGGCAGCAGCTAGG - Intergenic
1086243132 11:84720408-84720430 CTGCGGCAGTGGCAGCTCGCTGG + Intronic
1087391864 11:97545652-97545674 TTAAGTCAATGGCAGATGGTGGG + Intergenic
1089653904 11:119933272-119933294 CAGCGGCAGTGGCAGAAGCTGGG - Intergenic
1090751063 11:129746970-129746992 CTGTGGAAGTTGCAGATGGTGGG - Intergenic
1092427376 12:8385669-8385691 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1096227774 12:49877397-49877419 CTGTTTCAGTGGCAGAGGGTGGG + Intronic
1097497879 12:60365083-60365105 CTCCATTAATGGCAGATGGTAGG + Intergenic
1104486408 12:129154658-129154680 CTGGTTCAGTAACAGATGGTTGG + Intronic
1105230605 13:18491795-18491817 GTGCCTCAGTGGTAGATGGTAGG - Intergenic
1106591533 13:31102676-31102698 GTGAGGCAATGGCAGATGGTGGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109067492 13:57717154-57717176 CTGGGGCAGCGGCAGATGCTTGG - Intronic
1115805190 14:37043088-37043110 TTGTGTCTGTGGCAGAAGGTGGG - Intronic
1121601590 14:95208898-95208920 CTGAGTGAGTGACAGATGGGTGG - Intronic
1122843045 14:104476033-104476055 CAGCCTCAGTGGCAGGTGCTGGG + Intronic
1122864198 14:104596185-104596207 CTGCATCTGTTGCAGATGCTGGG + Intronic
1202909183 14_GL000194v1_random:101369-101391 GTGCGTCAGGGGCAGATGACAGG + Intergenic
1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG + Intergenic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1129648159 15:77457425-77457447 CTGTGTAAGTGGCTGATGTTTGG + Intronic
1129657232 15:77532279-77532301 GGGAGTCAGGGGCAGATGGTGGG + Intergenic
1134610101 16:15601294-15601316 CTGGGTCAGTGTTAGATGGAGGG - Intronic
1136450907 16:30353826-30353848 CTGCTCCCGTGGCAGTTGGTGGG - Intronic
1139300766 16:65943519-65943541 CAGCAACAGGGGCAGATGGTTGG - Intergenic
1139876180 16:70147949-70147971 TTGCGTCAGTGGCCGCTGTTAGG + Intronic
1140359610 16:74333149-74333171 TTGCGTCAGTGGCCGCTGTTAGG - Intergenic
1142271587 16:89092535-89092557 CTGTCCCAGTGGCAGAGGGTTGG + Intronic
1146155454 17:30520396-30520418 ATAAGTCAGTGGCAGATGCTTGG + Intronic
1148062737 17:44847900-44847922 CTGGGGAAGAGGCAGATGGTAGG + Exonic
1148141919 17:45335040-45335062 GTGCTTCTGTGGCAGATGCTGGG - Intergenic
1152583602 17:81179621-81179643 CTGGGTCAGGGGCAGAGTGTGGG - Intergenic
1154522800 18:15248073-15248095 GTGCCTCAGTGGTAGATGGTAGG + Intergenic
1158553757 18:58459014-58459036 CTGCTTCAGTTGCAGGGGGTTGG - Intergenic
1160357274 18:78239023-78239045 CTGCGTCAGGGGCAGGTGCCAGG - Intergenic
1160917513 19:1504220-1504242 AGGCGTCAGAGGCAGAGGGTTGG + Intergenic
1163406367 19:17125658-17125680 CTGCGTCTGTGGCTGACAGTTGG + Intronic
1164022221 19:21318042-21318064 GTGCCTCATTGGCAGATGGTAGG - Intronic
1164044270 19:21521996-21522018 GTGTTTCAGTGGCAGATGGTAGG + Intronic
1164094757 19:21997545-21997567 GTGCCTCAGTGGCAGATGGTGGG - Intronic
1164102199 19:22066480-22066502 GTGCCTCAGTGGCAGATGGTAGG + Intronic
1164114328 19:22203024-22203046 GTGCCTCAGTGGCAGATGGTGGG - Intergenic
1164139789 19:22448824-22448846 CTGCGTCAGTGGCAGATGGTAGG + Intronic
1164140599 19:22458298-22458320 GTACCTCAGTGGCAGATGGTAGG + Intronic
1164175855 19:22773763-22773785 CTGCCTCAATGGCAGATGGTAGG - Intronic
1164183551 19:22841015-22841037 GTGTGTCAATGGCAGATAGTAGG + Intergenic
1164198473 19:22994867-22994889 GTGCCTCAGTGGCAGATGGTAGG - Intronic
1164240143 19:23379856-23379878 GTACCACAGTGGCAGATGGTAGG - Intronic
1164284332 19:23799578-23799600 ATACCGCAGTGGCAGATGGTAGG + Intronic
1164502749 19:28833217-28833239 CTTCGTCAGTGACACAGGGTAGG - Intergenic
1166720663 19:44994157-44994179 CTGCCTGAGTGGCACCTGGTTGG + Intergenic
926298206 2:11583383-11583405 CTGCGTCAGTGGTTGTTGGGAGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937322990 2:120972041-120972063 CTGCGTCAGCGCCAGAGGGGAGG - Exonic
938522087 2:132080925-132080947 GTGCCTCAGTGGTAGATGGTAGG + Intergenic
940777804 2:157902921-157902943 CTGGGGCAGTGGCAAATTGTAGG - Intronic
947891001 2:233620116-233620138 ATCTGTCATTGGCAGATGGTTGG + Intronic
947892602 2:233638746-233638768 ATCTGTCATTGGCAGATGGTTGG + Intronic
948720310 2:239895123-239895145 CTGGGTCAGTGATGGATGGTGGG - Intronic
1168771543 20:419714-419736 CTGCGTCAGTACCAGCAGGTGGG + Exonic
1170715128 20:18824663-18824685 GGGGGTCAGTGGCAGAAGGTTGG + Intronic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1174300086 20:49575517-49575539 CTGAATCAGAGGCAGAGGGTTGG + Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1176264210 20:64200256-64200278 GTGCTTCTGTGTCAGATGGTTGG + Intronic
1176774596 21:13120142-13120164 GTGCCTCAGTGGTAGATGGTAGG - Intergenic
1179598874 21:42462236-42462258 CTGAGTCAGTTGCAAATAGTAGG - Intergenic
1182080719 22:27526904-27526926 CTGTGGCAGTGGCAGTGGGTGGG - Intergenic
950171041 3:10839320-10839342 CTGGGTCAGGGGCAGATGAGAGG - Intronic
950305571 3:11913350-11913372 CTGCTTCAGTGGGAGAGGGATGG - Intergenic
950542128 3:13618979-13619001 CTGCGGCAGTGGCAGCGGGATGG - Exonic
950750415 3:15123837-15123859 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
951274678 3:20671030-20671052 CTGTGGAAGTGGCAGATGGTAGG + Intergenic
953351313 3:42218426-42218448 CTGCTACAGGGGCAGAGGGTGGG + Intronic
955196739 3:56811366-56811388 CTGGGGCTGGGGCAGATGGTGGG + Intronic
960865276 3:122193594-122193616 CTGTGTTACTGGCACATGGTAGG - Intronic
961096093 3:124158161-124158183 CTGCTTCAGGAGCAGAGGGTGGG - Intronic
961282058 3:125771722-125771744 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
961457655 3:127032171-127032193 CTGCGTGAGATGCAGGTGGTGGG + Intronic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
968376737 4:50179-50201 GTGCCTCAGTGGTAGATGGCAGG + Intergenic
969090539 4:4690766-4690788 CTCTGGCAGTGGCAGCTGGTGGG + Intergenic
969738290 4:9005677-9005699 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
976403425 4:84635197-84635219 CTGAGTAAGTGGCAGATATTCGG - Intronic
977115138 4:93014975-93014997 CTTAGTCAGTGGCAGAGGGATGG + Intronic
977466826 4:97392823-97392845 CTTTATCAGTAGCAGATGGTAGG + Intronic
978559243 4:110014433-110014455 CTGCGTCTGTGTCTGGTGGTGGG - Intergenic
982063245 4:151625360-151625382 CTGCCTGAGTGACAGAAGGTAGG + Intronic
984219213 4:176952895-176952917 CTATGTCAGTGGCAAATTGTAGG - Intergenic
997823268 5:137084788-137084810 CTGGGTCAGTGGCAGCTGAGAGG - Intronic
1002767496 6:254983-255005 CTGCATCCCTGGCACATGGTAGG - Intergenic
1003967006 6:11262323-11262345 CTGCGTTAGTGACAGATTGGTGG + Intronic
1004681384 6:17898729-17898751 GTGCGTGTGTGGCTGATGGTGGG - Intronic
1007415853 6:41690867-41690889 CTGCGACTGCTGCAGATGGTAGG + Exonic
1012951002 6:105517956-105517978 CTGGGTCAGTAGCATATGGACGG - Intergenic
1013764452 6:113558487-113558509 CTCCTGCAGTGGCAGATGTTGGG - Intergenic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1018927372 6:168215608-168215630 GTGCGACAGTGGCAGGTGGTTGG - Intergenic
1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG + Intronic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1020091687 7:5345543-5345565 CTGGGTAAGTGGCAGCAGGTGGG - Exonic
1024149284 7:46553443-46553465 CACCTTCAGTGGCAGATGCTAGG - Intergenic
1025779809 7:64591223-64591245 GTGCCTCAGTAGCAGATGGTAGG + Intergenic
1025791108 7:64687490-64687512 CTGCCTCAGTGGCAGATGGTAGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1034342019 7:150363559-150363581 CTGGCACAGTGGCAGATGGTGGG + Intergenic
1036890920 8:12596542-12596564 GTGCGTAAGTGGGAAATGGTAGG - Intergenic
1036898465 8:12654458-12654480 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1038522490 8:28245202-28245224 CTGCCTCAGTGGGAGGTGATTGG - Intergenic
1039122444 8:34162503-34162525 CTGCATGAGTGGCAGATGGAAGG + Intergenic
1052686003 9:31756814-31756836 CTGCGTAAGTGGCAGAAGACTGG - Intergenic
1052847865 9:33353260-33353282 CTGTGTCAATGACAAATGGTAGG - Intronic
1055451358 9:76433775-76433797 CTGTGTCAGTACCAGATAGTAGG + Intronic
1061672182 9:132194864-132194886 CTGCTGCAGTGGCACCTGGTGGG + Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062397521 9:136358432-136358454 CTGCGGCAGGGGCAGAAGGGAGG - Exonic
1203482590 Un_GL000224v1:20478-20500 GTGCATCAGGGGCAGATGATAGG - Intergenic
1203482604 Un_GL000224v1:20593-20615 GTGCGTCAGGGGCAGATGACAGG - Intergenic
1203572493 Un_KI270744v1:144067-144089 GTGCCTCAGTGGTAGATGGCAGG - Intergenic
1189138610 X:38577348-38577370 CTGTGACCATGGCAGATGGTGGG - Intronic
1198437405 X:136630560-136630582 CTGAGTGAGGGGCAGAAGGTGGG + Intergenic
1200034636 X:153319517-153319539 CTGCCGCAGTCGCAGGTGGTTGG + Intergenic
1200395424 X:155983765-155983787 CTGCTGCAGGGGCAGATGTTGGG + Intergenic