ID: 1164142573

View in Genome Browser
Species Human (GRCh38)
Location 19:22486311-22486333
Sequence GCTTCCGAAGTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 3, 2: 13, 3: 26, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164142571_1164142573 -2 Left 1164142571 19:22486290-22486312 CCGCCATGTGTAGACTGGTCAGC 0: 1
1: 2
2: 1
3: 5
4: 73
Right 1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG 0: 1
1: 3
2: 13
3: 26
4: 115
1164142572_1164142573 -5 Left 1164142572 19:22486293-22486315 CCATGTGTAGACTGGTCAGCTTC 0: 5
1: 11
2: 26
3: 58
4: 191
Right 1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG 0: 1
1: 3
2: 13
3: 26
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164142573 Original CRISPR GCTTCCGAAGTGACCAGAGC AGG Intronic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902990812 1:20186033-20186055 GCTTCCGGCGTGACCGGAACCGG - Intergenic
904470315 1:30731973-30731995 TCTTCCCCAGTGTCCAGAGCAGG + Intergenic
904965314 1:34368109-34368131 GCTACCGAAGTGAGCAGAAGGGG + Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905866106 1:41377597-41377619 GCTCCCCAGGTGCCCAGAGCTGG - Intronic
917981426 1:180271998-180272020 GCTTCCGAGGTGAGCAGGGCTGG + Exonic
923095578 1:230772885-230772907 ACTTCCCAAGGGACCAGAGCTGG - Intronic
924530528 1:244889928-244889950 GCATCAGAAGTGCCAAGAGCTGG - Intergenic
1063402311 10:5758168-5758190 ACTTCCAATGTGATCAGAGCCGG - Intronic
1064261385 10:13788964-13788986 GATTCCCAAGTGCCCAGGGCTGG - Intronic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1073176899 10:101562235-101562257 GCATGCCAAGTGAACAGAGCAGG + Intergenic
1073968487 10:109019285-109019307 GCTTCCTAAGTAACCAAATCTGG - Intergenic
1075923351 10:126231621-126231643 TCTTTCCATGTGACCAGAGCAGG - Intronic
1076007016 10:126955991-126956013 GCTCCCGACTTGACCAGACCTGG - Intronic
1076856259 10:133116793-133116815 GACTCGGAACTGACCAGAGCTGG - Intronic
1077639424 11:3868024-3868046 GCTTGCCAAGTTCCCAGAGCTGG + Intronic
1080421944 11:32118249-32118271 GCTTCAGAAGGCACCAAAGCAGG - Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1083629232 11:64087286-64087308 ACATCCGAAGTGACAGGAGCAGG - Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1089769138 11:120790167-120790189 GCTTTCAAAGTGTCCAGAGAAGG - Intronic
1090030768 11:123204213-123204235 GCCTCTGAAGTGAGCAGAGATGG + Intergenic
1090670641 11:128942880-128942902 GCTTTCGGAGTGAGCTGAGCAGG + Exonic
1092461148 12:8687424-8687446 GTTTCAGAAGTGACCACAGAAGG - Intronic
1102199279 12:111046272-111046294 GCTTGCGGAGAGACCAGTGCAGG + Intronic
1107955673 13:45508845-45508867 AATTCCCAGGTGACCAGAGCGGG - Intronic
1110862400 13:80357591-80357613 GCTTCCCCACTGAACAGAGCAGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1120689658 14:87578413-87578435 GCTTTGGAAGTCACCAGAGTGGG - Intergenic
1123218934 14:106839144-106839166 GCTTCCGAAGTAAGCAGAGCCGG + Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1130284124 15:82541247-82541269 CCTTCCGAAGCCACCAGCGCAGG + Intronic
1132579943 16:680200-680222 GGTTCCGAAGAGACCTCAGCAGG + Intronic
1133265327 16:4579958-4579980 GCTTCTGAAGTTACCATGGCCGG - Intronic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1134456699 16:14400348-14400370 GCTTCTGAAGTGGGGAGAGCCGG + Intergenic
1134625523 16:15720072-15720094 GCCACCGAAGTCAGCAGAGCGGG - Intronic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1139500609 16:67361368-67361390 GTTTCCAAAGTGGCCAGAACTGG + Intronic
1140815164 16:78614510-78614532 GCTTCAGAAGTGAGCCCAGCAGG - Intronic
1141586391 16:85036394-85036416 GTTTACGAAATGTCCAGAGCAGG - Intronic
1151212021 17:72551597-72551619 GCATCAGAAGTGCCAAGAGCTGG + Intergenic
1151804489 17:76397077-76397099 GCTGACGAAGTGCACAGAGCAGG - Intronic
1151911957 17:77089241-77089263 GCATTCGAAGTGACCTCAGCAGG + Exonic
1152320825 17:79608219-79608241 CCTTCCGCAGGGACCAGAGGCGG - Intergenic
1152672104 17:81614780-81614802 GGGTCCCAAGTGACCAGAGATGG + Intronic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1155774927 18:29749329-29749351 GCTTCTGAAGTGAACTGAGTTGG - Intergenic
1156493432 18:37510448-37510470 GCTTCCTTAGTGACCCCAGCAGG + Intronic
1160562241 18:79765812-79765834 GCTTCTGAAGAGAGGAGAGCTGG + Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164010589 19:21200397-21200419 GCTTCCACTGTGATCAGAGCAGG + Intergenic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1165279261 19:34782705-34782727 TCTTCCCTAGTGACCTGAGCTGG - Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
934759784 2:96848159-96848181 GCTTCCACAGTGACCAGACTGGG + Exonic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
937900636 2:127016503-127016525 GCTTCTGAAGGGGCCACAGCCGG + Intergenic
947154324 2:227146186-227146208 GCTTCGGACCTGACCCGAGCTGG - Intronic
948595356 2:239076164-239076186 GCTTCCCAGGGGAACAGAGCTGG + Intronic
1170105376 20:12749708-12749730 GCTTCAGAAGTGATTAGAGATGG + Intergenic
1171951019 20:31422389-31422411 ACTTTCTCAGTGACCAGAGCTGG - Intergenic
1172875064 20:38159012-38159034 GCTGCGGAAGTGACCGGGGCAGG + Intronic
1174452897 20:50630746-50630768 GCTTCAGCAGTGCACAGAGCCGG - Exonic
1178311652 21:31534967-31534989 GCTTCCCAAGTAGCCAGGGCTGG - Intronic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
950674402 3:14545871-14545893 GTTTCAGCAGTGAACAGAGCAGG + Intergenic
953051725 3:39350243-39350265 GCTTCCGGTGTGGTCAGAGCAGG - Intergenic
957454563 3:80424209-80424231 CCTTCAGAAGCGATCAGAGCAGG - Intergenic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
969619244 4:8270619-8270641 AGTTCTGAAGAGACCAGAGCTGG - Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971297326 4:25408360-25408382 ACTTCCCAAATGACCAAAGCAGG - Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
975359648 4:73453340-73453362 GCTTGCTAAGTGAGCAGTGCAGG + Intronic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
986505118 5:8441684-8441706 GCTTCTGAAGTGAGAAGAGTGGG + Intergenic
991537446 5:67686456-67686478 GCCACAGAAGTGACCTGAGCAGG - Intergenic
998375547 5:141688229-141688251 GCTTTGGGAGTGACCAGAGGGGG + Intergenic
999028978 5:148268842-148268864 ACATCCAAAGTGACAAGAGCAGG + Exonic
1001298345 5:170515114-170515136 GCTTTGGAAGTGGCCAAAGCTGG - Intronic
1001381609 5:171309778-171309800 GCTTCACAGGTGAGCAGAGCTGG + Exonic
1001492812 5:172167766-172167788 GCTACCGTATTGAACAGAGCAGG + Intronic
1001795995 5:174502882-174502904 GCTTCCCTAGTACCCAGAGCAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007823357 6:44578716-44578738 GCTGCAGAACTGACCAGATCTGG + Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1012630104 6:101455355-101455377 GCTTCTTAAGTGACTAGAGTGGG + Intronic
1014145990 6:117998933-117998955 GCTCCCGAAGTGCCTAGAACCGG - Intronic
1016272156 6:142301854-142301876 GCTTCCGGCGTGACTGGAGCTGG - Intronic
1016447746 6:144150469-144150491 GCTTAGGAAGCGACCACAGCTGG - Intergenic
1018562530 6:165117486-165117508 CCATCCGAAGTGAAGAGAGCAGG - Intergenic
1018737419 6:166697859-166697881 GCTACAGAAGTGAGCAGAGCAGG - Intronic
1019309457 7:353131-353153 GCTTCCCAAGGGGCCATAGCAGG - Intergenic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026051813 7:66953058-66953080 GCCTCCTAAATGACCAAAGCTGG - Intronic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1035412573 7:158656910-158656932 GCTTCTTCAGTGTCCAGAGCTGG - Intronic
1036643891 8:10600532-10600554 GCTTCCGTGGTGACCAGGGGCGG + Intergenic
1037732989 8:21544875-21544897 TCTGCCGAAGAGACCCGAGCGGG - Intergenic
1039078420 8:33713087-33713109 GATTCCCAAGAGACCAAAGCAGG - Intergenic
1039078424 8:33713112-33713134 GCTTCCCAAGAGAACAAAGCAGG - Intergenic
1039443352 8:37611058-37611080 GCTTTGGAAGTGCTCAGAGCTGG - Intergenic
1040689929 8:49924499-49924521 CCTCCAGAAGTGAGCAGAGCCGG + Intronic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1042041464 8:64595537-64595559 GGTTCCCAAGGGACCAAAGCGGG + Intronic
1045297917 8:100888453-100888475 GCTTGGGAAGTGCCCAGGGCTGG - Intergenic
1048296485 8:133218399-133218421 GCGTCCAAGGTGACCACAGCGGG - Intronic
1053143704 9:35697871-35697893 GCTTCGGAAGGAACGAGAGCTGG - Exonic
1054735821 9:68748971-68748993 GCTTCTGAGGTGGACAGAGCTGG + Intronic
1057751169 9:97794432-97794454 GGTTCAGAAGTGACCACAGAAGG + Intergenic
1061069477 9:128300232-128300254 CCTTCAGAAGTGACTACAGCAGG - Intergenic
1061221991 9:129257637-129257659 GCTTCCCCAGGGCCCAGAGCAGG - Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062578269 9:137218449-137218471 GCTCCCGCAGGGTCCAGAGCCGG - Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1199754637 X:150852674-150852696 TCATCTGAGGTGACCAGAGCAGG - Intronic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202168721 Y:22018600-22018622 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202222640 Y:22567768-22567790 GCTTTCGGAATGACCAGAGTAGG + Intergenic
1202320475 Y:23627892-23627914 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202550292 Y:26042164-26042186 GCTTTCGGAATGACCAGAGTAGG + Intergenic