ID: 1164144396

View in Genome Browser
Species Human (GRCh38)
Location 19:22502677-22502699
Sequence GCTCAAAACAAGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 20, 3: 30, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164144396_1164144401 20 Left 1164144396 19:22502677-22502699 CCAAGCTCCATCTTGTTTTGAGC 0: 1
1: 0
2: 20
3: 30
4: 197
Right 1164144401 19:22502720-22502742 ATCTTGCTCTGAACTCCATCTGG 0: 1
1: 0
2: 0
3: 6
4: 131
1164144396_1164144398 -9 Left 1164144396 19:22502677-22502699 CCAAGCTCCATCTTGTTTTGAGC 0: 1
1: 0
2: 20
3: 30
4: 197
Right 1164144398 19:22502691-22502713 GTTTTGAGCTCCACCTTCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1164144396_1164144402 25 Left 1164144396 19:22502677-22502699 CCAAGCTCCATCTTGTTTTGAGC 0: 1
1: 0
2: 20
3: 30
4: 197
Right 1164144402 19:22502725-22502747 GCTCTGAACTCCATCTGGCTTGG 0: 1
1: 0
2: 0
3: 28
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164144396 Original CRISPR GCTCAAAACAAGATGGAGCT TGG (reversed) Intronic
900247736 1:1645826-1645848 GCTAGAAACAAGAAGGAGCAAGG - Intronic
900258963 1:1712964-1712986 GCTAGAAACAAGAAGGAGCAAGG - Intronic
902036687 1:13463130-13463152 GCACAAATCAGGATGGAGCTCGG - Intergenic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
904789606 1:33009195-33009217 TCCCAAAACAAGAGGGAGCTGGG - Intronic
905191306 1:36237159-36237181 TCTCAAAACAAAAAGCAGCTAGG + Intronic
907157867 1:52351068-52351090 TCTCAGGACAAGATGAAGCTGGG + Exonic
910399210 1:86821645-86821667 GCTTAAAAGAAGATGGAGATTGG - Intergenic
912701429 1:111881215-111881237 GATTAAAAAAAGATGGAGGTGGG - Intronic
918138894 1:181703390-181703412 GATCACACCACGATGGAGCTAGG + Intronic
921997024 1:221431538-221431560 GCTGAGAACAAGAACGAGCTGGG - Intergenic
1064118495 10:12599263-12599285 TCTCAAAATAAGATGCAGCAGGG - Intronic
1065818320 10:29501785-29501807 AATCAAACCAAGATGGCGCTTGG + Intronic
1067242861 10:44510804-44510826 CCAGAAAACAAGATGCAGCTAGG + Intergenic
1068985583 10:63104981-63105003 GTTAGAAGCAAGATGGAGCTGGG + Intergenic
1070612119 10:77940565-77940587 GCTCAGAACAAGAGGGAGGTGGG - Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1073881159 10:107981479-107981501 GTAAAAAACAAGATGGAGCAGGG - Intergenic
1074281389 10:112054980-112055002 GATCAAAACATGAAGGAACTGGG - Intergenic
1079057722 11:17220989-17221011 GCTGACAACAATATGGAGGTCGG + Intronic
1082890051 11:58129529-58129551 GATCAAAACCAGAGGGAGGTTGG - Intronic
1084104406 11:66971673-66971695 GGTTAAAACAAAAAGGAGCTGGG + Intergenic
1085468626 11:76741598-76741620 GCACAAAACAGGAGGGACCTGGG + Intergenic
1087595468 11:100248475-100248497 GGTCAAAGCAAGAGTGAGCTAGG + Intronic
1092880428 12:12883879-12883901 GATAAAAACAAGATGGAGGCAGG + Intergenic
1094346009 12:29469865-29469887 TCTCAAAACAAGATGGGGTCAGG + Intronic
1100183877 12:92115944-92115966 GCTGAAAATGAGATGGAGTTAGG - Intronic
1101648911 12:106656893-106656915 GCTGAAGATAAGATGGAGTTCGG - Intronic
1105895501 13:24714361-24714383 GCCCAGAACAAGATAGAGCATGG + Intergenic
1111392466 13:87614893-87614915 TCTCAAACCAAGATGAAGGTAGG + Intergenic
1112149947 13:96747823-96747845 GCTCAAAAAATGATGATGCTAGG + Intronic
1112797534 13:103072437-103072459 GCTATAAACAACAGGGAGCTTGG + Intergenic
1114067099 14:19070173-19070195 ACTCAGAGCCAGATGGAGCTAGG + Intergenic
1114067108 14:19070239-19070261 GCTCAGAGCAAGATGGAGCTTGG + Intergenic
1114067111 14:19070272-19070294 GCTCCAAGCAAGATGGAGCTTGG + Intergenic
1114067121 14:19070384-19070406 GCTCCAAGCAAGATGGAGCTTGG + Intergenic
1114067143 14:19070727-19070749 GCTCCAAGCAAGATGGAACTTGG + Intergenic
1114067162 14:19071032-19071054 GCTCTCAGCAAGCTGGAGCTCGG + Intergenic
1114067168 14:19071098-19071120 GCTCTAAGCAAGATGGAGCTTGG + Intergenic
1114067185 14:19071325-19071347 ACTCAGAGCAAGATGGAGTTTGG + Intergenic
1114067190 14:19071358-19071380 GCTCTGAGAAAGATGGAGCTTGG + Intergenic
1114067201 14:19071490-19071512 GCTCAGAGCAAGATGGAGCTTGG + Intergenic
1114067209 14:19071573-19071595 GCTCCAAACAAAATGGAACTTGG + Intergenic
1114067220 14:19071749-19071771 GCTCTAAGCAAGATGGAGTTTGG + Intergenic
1114067236 14:19071930-19071952 GCTCCCAGCAAGATGGGGCTTGG + Intergenic
1114067245 14:19072045-19072067 GCTCACAGCAAGATAGTGCTTGG + Intergenic
1114067251 14:19072111-19072133 GCTCTGAGCAAGATGGAGCTTGG + Intergenic
1114095009 14:19327916-19327938 GCTCTGAGCAAGATGGAGCTTGG - Intergenic
1114095015 14:19327982-19328004 GCTCACAGCAAGATAGTGCTTGG - Intergenic
1114095024 14:19328097-19328119 GCTCCCAGCAAGATGGGGCTTGG - Intergenic
1114095042 14:19328278-19328300 GCTCTAAGCAAGATGGAGTTTGG - Intergenic
1114095053 14:19328455-19328477 GCTCCAAACAGAATGGAACTTGG - Intergenic
1114095061 14:19328538-19328560 GCTCAGAGCAAGATGGAGCTTGG - Intergenic
1114095072 14:19328670-19328692 GCTCTGAGAAAGATGGAGCTTGG - Intergenic
1114095077 14:19328703-19328725 ACTCAGAGCAAGATGGAGTTTGG - Intergenic
1114095094 14:19328930-19328952 GCTCTAAGCAAGATGGAGCTTGG - Intergenic
1114095100 14:19328996-19329018 GCTCTCAGCAAGCTGGAGCTCGG - Intergenic
1114095119 14:19329301-19329323 GCTCCAAGCAAGATGGAACTTGG - Intergenic
1114095130 14:19329466-19329488 GATCTAAGCAAGATGGAGCTTGG - Intergenic
1114095144 14:19329644-19329666 GCTCCAAGCAAGATGGAGCTTGG - Intergenic
1114095154 14:19329756-19329778 GCTCCAAGCAAGATGGAGCTTGG - Intergenic
1114095157 14:19329789-19329811 GCTCAGAGCAAGATGGAGCTTGG - Intergenic
1114095166 14:19329855-19329877 ACTCAGAGCCAGATGGAGCTAGG - Intergenic
1114624359 14:24119123-24119145 CCTAAAAGCAAGAAGGAGCTGGG - Exonic
1115922361 14:38390266-38390288 GCTCCAAACCAGAAGTAGCTTGG + Intergenic
1119791987 14:77359203-77359225 GATAAAAACAAGTTGTAGCTGGG - Intronic
1120486730 14:85123579-85123601 TCTCAAAAAAGGATGGGGCTGGG - Intergenic
1120944560 14:89981961-89981983 GCTCAAACTAAGATGTAACTTGG - Intronic
1122351631 14:101097985-101098007 GCTCCAAACCAGAAGGAGTTCGG - Intergenic
1124094016 15:26631860-26631882 GCTTAAAGCAAGATGGAGGGAGG - Intronic
1125010634 15:34869546-34869568 TCTCATAACAAGATGGAAATAGG - Intronic
1128318456 15:66676154-66676176 TCTGTAAACTAGATGGAGCTGGG + Intronic
1129079363 15:73025513-73025535 GCTCAAAACCTTATGGAGCCAGG + Intergenic
1129279888 15:74476234-74476256 TCTCAAAAGAAGATGGAACTTGG + Intergenic
1130747856 15:86675289-86675311 GCTCAAAATAAGATGGCCCCAGG - Intronic
1131409398 15:92194186-92194208 AGTCAAAAGAAGATGGAACTGGG + Intergenic
1132121735 15:99181761-99181783 GCTAAGAAAAAGACGGAGCTGGG + Intronic
1133058262 16:3158317-3158339 GCTCAGGCCAAGAAGGAGCTCGG + Intergenic
1133062850 16:3186453-3186475 GCTGAAAACAACATGAGGCTGGG + Intergenic
1134358535 16:13507506-13507528 TCCCAAAACAAGATGAGGCTGGG - Intergenic
1135547604 16:23376557-23376579 GCTCACAACCAATTGGAGCTGGG + Intronic
1135873853 16:26178706-26178728 GCTCCAAACAACAGGGAACTTGG - Intergenic
1137524106 16:49218776-49218798 GCTCCACACAAAATGAAGCTGGG + Intergenic
1137814236 16:51383186-51383208 CCTCAAAACAACATGCAGATGGG + Intergenic
1138941013 16:61789846-61789868 GCCCAAAGCAAGATGGCACTAGG + Intronic
1139746683 16:69080767-69080789 GCTAAAAAAATGATGGAGCCAGG - Intronic
1140298918 16:73737413-73737435 GATCAAAACAAGACACAGCTTGG - Intergenic
1141994994 16:87630677-87630699 GCTAAAAACAAAATAGAGCTTGG + Intronic
1142644066 17:1300798-1300820 GCTAGAACCAAGATGGAGCCGGG - Exonic
1152509407 17:80775187-80775209 GCTGAAAACAAGAAGGAAGTGGG - Intronic
1153159916 18:2192438-2192460 GCAAAAAGCAAGATGGGGCTGGG - Intergenic
1155060592 18:22224657-22224679 GATAAAAACAAGAAGGTGCTTGG - Intergenic
1157691876 18:49689964-49689986 GCTCAAAAAGAGATGGGGCATGG + Intergenic
1162090206 19:8274658-8274680 TCTCAAAAAAAGAAGGGGCTGGG - Intronic
1162319739 19:9964177-9964199 GAACAAAACAATATGGGGCTGGG + Intronic
1163442858 19:17330292-17330314 GCTCAGCCCAAGGTGGAGCTAGG + Intronic
1164144396 19:22502677-22502699 GCTCAAAACAAGATGGAGCTTGG - Intronic
1164144408 19:22502794-22502816 GCTTCAAGCAAGATGGAGCAAGG - Intronic
1165675968 19:37723579-37723601 GCTTAAAAGATGATTGAGCTGGG - Intergenic
1167412392 19:49352535-49352557 TCTCAAAAAAAAATAGAGCTGGG - Intronic
1168071147 19:53952573-53952595 CCTCAGAACAGGAAGGAGCTGGG + Intergenic
926361969 2:12097610-12097632 GTTTAAAAGAAGATGGAGTTGGG + Intergenic
927133534 2:20080398-20080420 GCACAAAACAAGGTGGAGAGGGG + Intergenic
929214190 2:39393125-39393147 ACTCAAAACAAATTGGAGGTAGG - Intronic
930169876 2:48240466-48240488 GCTCAAAATCAGGTGGAGGTGGG + Intergenic
935050004 2:99517477-99517499 GCTCAAAACAAAAATTAGCTAGG - Intergenic
937223471 2:120355204-120355226 GCTCACAACAACCTGGAGGTGGG + Intergenic
938484492 2:131690282-131690304 ACTCAGAGTAAGATGGAGCTGGG + Intergenic
938484500 2:131690348-131690370 GCTCAGAGCAAGATGGAGCTTGG + Intergenic
938484508 2:131690460-131690482 GCTCCAAGCAAGATGGAGCTTGG + Intergenic
938484514 2:131690510-131690532 GCTCAGAGCAAGATAAAGCTTGG + Intergenic
938484522 2:131690638-131690660 GATCTAAGCAAGATGGAGCTTGG + Intergenic
938484532 2:131690804-131690826 GCTCCAAGCAAGATGGAACTTGG + Intergenic
938484554 2:131691109-131691131 GCTCTCAGCAAGATGGAGCTCGG + Intergenic
938484559 2:131691175-131691197 GCTCTAAGCAAGATGGAGCTTGG + Intergenic
938484574 2:131691435-131691457 GCTCTGAGAAAGATGGAGCTTGG + Intergenic
938484580 2:131691501-131691523 GCTCTAAGCAAGATGGAGCTTGG + Intergenic
938484584 2:131691550-131691572 GCTCAGAGCAAGATGGAGCTTGG + Intergenic
938484591 2:131691633-131691655 GCTCCAAACAAAATGGAACTTGG + Intergenic
938484604 2:131691810-131691832 GCTCTAAGCAAGATGGAGTTTGG + Intergenic
938484633 2:131692106-131692128 GCTCACAGCAAGATAGTGCTTGG + Intergenic
938484639 2:131692172-131692194 GCTCTGAGCAAGATGGAGCTTGG + Intergenic
938484646 2:131692288-131692310 GCTCAGAGTAAGATTGAGCTCGG + Intergenic
939416968 2:141912504-141912526 AGTGAAAAGAAGATGGAGCTAGG + Intronic
940506949 2:154567653-154567675 GCTTAAAAGAAGATGGAGGTGGG + Intergenic
940613444 2:156020564-156020586 GATCATCACAAGATGGAGTTAGG + Intergenic
941436531 2:165480007-165480029 GCCAAAAACAAGAATGAGCTTGG - Intronic
942164751 2:173231203-173231225 GCCCAAAACCAGGTTGAGCTAGG - Intronic
944099312 2:196005330-196005352 ACTCAAAACAAGAAGGAGAAGGG + Intronic
947020119 2:225665565-225665587 TCTCAAAAAAAAAAGGAGCTAGG - Intergenic
1168956259 20:1836536-1836558 GCTCAAAGGAAGAGGGAGCGGGG - Intergenic
1169426347 20:5500413-5500435 GCTCAAAGCAAGCTGGGCCTTGG - Intergenic
1171060048 20:21947681-21947703 ACTCAAATCCAGATGGAGTTTGG + Intergenic
1174157603 20:48526536-48526558 GCTCAAAAGATGATGGAAATTGG + Intergenic
1177577152 21:22972709-22972731 AATCAAAACAGGATGGTGCTGGG - Intergenic
1179019179 21:37622877-37622899 GCACAAAACAAGATGGAATAGGG - Exonic
1180485576 22:15792757-15792779 ACTCAGAGCCAGATGGAGCTAGG + Intergenic
1180485585 22:15792823-15792845 GCTCAGAGCAAGATGGAGCTTGG + Intergenic
1180485588 22:15792856-15792878 GCTCCAAGCAAGATGGAGCTTGG + Intergenic
1180485598 22:15792968-15792990 GCTCCAAGCAAGATGGAGCTTGG + Intergenic
1180485612 22:15793146-15793168 GATCTAAGCAAGATGGAGCTTGG + Intergenic
1180485620 22:15793294-15793316 GCTCCAAGCAAGATGGAACTTGG + Intergenic
1180485639 22:15793599-15793621 GCTCTCAGCAAGCTGGAGCTCGG + Intergenic
1180485644 22:15793665-15793687 GCTCTAAGCAAGATGGAGCTTGG + Intergenic
1180485661 22:15793892-15793914 ACTCAGAGCAAGATGGAGTTTGG + Intergenic
1180485666 22:15793925-15793947 GCTCTGAGAAAGATGGAGCTTGG + Intergenic
1180485677 22:15794057-15794079 GCTCAGAGCAAGATGGAGCTTGG + Intergenic
1180485685 22:15794140-15794162 GCTCCAAACAAAATGGAACTTGG + Intergenic
1180485696 22:15794317-15794339 GCTCTAAGCAAGATGGAGTTTGG + Intergenic
1180485712 22:15794498-15794520 GCTCCCAGCAAGATGGGGCTTGG + Intergenic
1180485721 22:15794613-15794635 GCTCACAGCAAGATAGTGCTTGG + Intergenic
1180485727 22:15794679-15794701 GCTCTGAGCAAGATGGAGCTTGG + Intergenic
1180604624 22:17047955-17047977 TCTCAAAACAAGACAGGGCTGGG + Intergenic
1181592024 22:23891324-23891346 GCTCACAACCAGATTGAACTTGG - Intronic
1183543000 22:38440734-38440756 GCTCAAAAGGAGATGGATTTGGG + Intronic
1183667282 22:39253250-39253272 CATCAAAACAGGAAGGAGCTGGG - Intergenic
1184845096 22:47078000-47078022 GCTAAATACAAGATGCTGCTGGG - Intronic
949877344 3:8634828-8634850 TCTCAAAACAAGGTGGATATGGG + Intronic
950364528 3:12473751-12473773 GTTCAAATCAAAATGGTGCTTGG + Intergenic
950780991 3:15391376-15391398 GCTAAAAGCAAGATGGAGATTGG - Intronic
951132952 3:19069530-19069552 GCTCCAGACATGATGGAGCAGGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
953638988 3:44687974-44687996 GCTGGAAACCAGCTGGAGCTAGG - Intergenic
955668139 3:61371932-61371954 GGTCAACTCAAGCTGGAGCTAGG - Intergenic
955805707 3:62731876-62731898 GCTGAAAACAAAAGGGCGCTGGG + Intronic
956131506 3:66057828-66057850 ACTTAAAAGAAGATGGATCTTGG - Intergenic
956712722 3:72052218-72052240 GCTGAAAACCAGATGGTGGTTGG - Intergenic
958052515 3:88366367-88366389 ACTGAAAACCAGATGAAGCTGGG + Intergenic
958615040 3:96482465-96482487 GCTTAAAACAAGATAGAATTGGG - Intergenic
958985884 3:100779025-100779047 GCTCAAAATAAAAGGCAGCTGGG - Intronic
959280897 3:104337654-104337676 GCCCAAAACAAGATACATCTTGG - Intergenic
960176038 3:114518753-114518775 GCCTAAAGCAAGATGCAGCTTGG - Intronic
960895667 3:122502186-122502208 ACTAAATACAAGATAGAGCTAGG + Intronic
961466111 3:127082675-127082697 CCTCAAAACAAGCTGGGGCCGGG - Intergenic
962006308 3:131353241-131353263 GCTCAAAAGAAAAAAGAGCTAGG + Intergenic
962791797 3:138817989-138818011 GCTTAAGTCAAGATGGGGCTGGG + Intronic
966494905 3:180568849-180568871 TATCAAAAAATGATGGAGCTCGG - Intergenic
966578246 3:181528194-181528216 ACTCAACCCAAGATGGAGCAAGG - Intergenic
970157035 4:13152033-13152055 ACACAGAGCAAGATGGAGCTAGG + Intergenic
970717587 4:18944686-18944708 TCTCAGAAGGAGATGGAGCTAGG + Intergenic
972441399 4:39097045-39097067 GCTCAAAGAATGATGGAGATAGG + Intronic
973653445 4:53020790-53020812 GGATTAAACAAGATGGAGCTAGG + Intronic
974419430 4:61653408-61653430 GCCCAAGACAAAATGGAGTTTGG + Intronic
974948319 4:68555525-68555547 GTTAAAAGCAAGATGGAGTTAGG + Intronic
975115529 4:70676675-70676697 GCACAAAATAAGAAAGAGCTTGG + Intronic
977956394 4:103032453-103032475 GCTCCACAGAAAATGGAGCTGGG + Intronic
978906817 4:114015183-114015205 ACTCAAGACAAGATGGTGTTAGG - Intergenic
981909168 4:149958145-149958167 GCTAAAAACAAGATAGTTCTAGG - Intergenic
982216734 4:153088755-153088777 AGTAAAAACAAAATGGAGCTGGG - Intergenic
982998496 4:162381771-162381793 GATAAAAAGAAGATGGGGCTGGG + Intergenic
984651663 4:182277185-182277207 GGTCAGAATAAGATGGAGTTTGG + Intronic
985995135 5:3593510-3593532 CCTCAAAACACCAGGGAGCTGGG - Intergenic
991360000 5:65810046-65810068 GCTCAAAACAATCTGGCGCAGGG - Exonic
992936083 5:81706767-81706789 GCTCAAAACAAAACAGAGCTAGG + Intronic
993098644 5:83509813-83509835 GCTCAAAGCAACATGGAGAAAGG - Intronic
994116433 5:96066456-96066478 GCTCAAAACAAGCTAGAGAAAGG - Intergenic
997241422 5:132311170-132311192 GCCCCATCCAAGATGGAGCTAGG + Intronic
1000758946 5:165197132-165197154 GTTCAAAAGATGTTGGAGCTTGG - Intergenic
1000858352 5:166428151-166428173 GCTCAAAGTGAGAGGGAGCTGGG + Intergenic
1001287486 5:170434657-170434679 TCTAAAAACAAGATGGGGCCTGG + Intronic
1002114558 5:176948739-176948761 ATTCAAAACATGGTGGAGCTGGG + Intronic
1002796103 6:472099-472121 GCTCAAAACAAGGTGGCATTTGG - Intergenic
1003000740 6:2330332-2330354 GCCCAAAACAAGATGTAGGCAGG + Intergenic
1005181586 6:23113329-23113351 GCTGGAAACAAAATGGAGTTGGG - Intergenic
1006799899 6:36753096-36753118 CTTCAAAACAAAAGGGAGCTTGG + Intronic
1008667007 6:53726321-53726343 GCTGAAAAAAAGATGTGGCTGGG + Intergenic
1009613863 6:65980344-65980366 GGTCAGAACAAGATGGGGTTGGG - Intergenic
1012658814 6:101860128-101860150 GATCTAAACAAGATGGTTCTTGG + Intronic
1013153891 6:107474889-107474911 TCTGAAATCAAGATGTAGCTGGG + Intergenic
1013351327 6:109308649-109308671 CTTCAAAACAATATGGAGGTGGG + Intergenic
1016505067 6:144769988-144770010 GCTCAAAAGACCATGGAGCCGGG - Intronic
1016559792 6:145383171-145383193 GCACAAAGCATGCTGGAGCTGGG + Intergenic
1017732280 6:157327310-157327332 GTTCAAAACAAGCTAGAGCTAGG - Intergenic
1020352865 7:7241389-7241411 GTTCAAAACAATATGGTGCTGGG - Intronic
1022421785 7:30230202-30230224 TTTCAGTACAAGATGGAGCTAGG + Intergenic
1023279258 7:38553058-38553080 GTTCAAAGCAGGATGGAGCAGGG - Intronic
1023652089 7:42382058-42382080 AGCCAGAACAAGATGGAGCTTGG - Intergenic
1026763692 7:73145873-73145895 GTTCAAATCATGATGGGGCTGGG - Intergenic
1027040162 7:74955643-74955665 GTTCAAATCATGATGGGGCTGGG - Intergenic
1027083476 7:75246713-75246735 GTTCAAATCATGATGGGGCTGGG + Intergenic
1029636980 7:101791155-101791177 TTTAAAAACAAGAGGGAGCTGGG - Intergenic
1030109946 7:106018529-106018551 CCTCAAAAAAATATGGGGCTGGG - Intronic
1030520472 7:110591517-110591539 GCTCATCACAAGATGGAGAAAGG + Intergenic
1031469255 7:122149580-122149602 GCTCAAAAGAAGATGGGGAAGGG - Intergenic
1031700672 7:124921235-124921257 TGTCAAAACTAGATGCAGCTTGG + Intronic
1034089948 7:148354566-148354588 GCTCAAAAGAAGAGGGGTCTTGG + Intronic
1036701303 8:11015685-11015707 GCTCAGAACCAGAAGGAGCGAGG + Intronic
1037887844 8:22604511-22604533 GCTCAAAGGAAGCGGGAGCTGGG - Intergenic
1042376016 8:68053834-68053856 GCATAAAACAAATTGGAGCTAGG - Intronic
1042594449 8:70430985-70431007 GCTCAAAACAAGCTGTATGTTGG + Intergenic
1043979011 8:86616555-86616577 ACTGTAAACAAAATGGAGCTGGG - Intronic
1044240280 8:89880351-89880373 GCTCAAGACAAGAAATAGCTTGG + Intergenic
1044885818 8:96775931-96775953 ACTCCAAACAAAATGGAGGTTGG + Intronic
1045397527 8:101775678-101775700 GCTCAGATCCAGATGGAGGTTGG + Intronic
1048475349 8:134737711-134737733 CCTCAAATCAGGATGGACCTGGG + Intergenic
1050297106 9:4216643-4216665 GCTTAAAACAAGAAGCAACTAGG - Intronic
1052283710 9:26760941-26760963 GCTAAAATCAAGATGTAGGTAGG - Intergenic
1056519352 9:87385761-87385783 GCTCACAAGAAGATGTATCTAGG - Intergenic
1056579062 9:87877136-87877158 ACTCAAACCAAGAGGGAACTCGG - Intergenic
1057815622 9:98291915-98291937 GCTGGAGGCAAGATGGAGCTGGG + Intronic
1059766144 9:117385873-117385895 GATCAAAAGAGGATGAAGCTGGG + Intronic
1187288164 X:17926070-17926092 GCTCCTTTCAAGATGGAGCTGGG - Intergenic
1189385831 X:40536173-40536195 TCTCAAAAAAAGGTGGAGGTGGG + Intergenic
1189852916 X:45194690-45194712 CCTCAAAACAAGATGGGGAAGGG - Intronic
1190451176 X:50582214-50582236 GCTCAGAACTAGAGTGAGCTTGG + Intergenic
1192813208 X:74567421-74567443 TCTTAAAATCAGATGGAGCTGGG - Intergenic
1193439552 X:81522241-81522263 ACTGAAGACAAAATGGAGCTGGG - Intergenic
1197657829 X:129136694-129136716 GCTAAAATCAAGATGCAGGTAGG - Intergenic