ID: 1164145399

View in Genome Browser
Species Human (GRCh38)
Location 19:22509785-22509807
Sequence CACTTAGCTCAGATGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164145399_1164145416 29 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145416 19:22509837-22509859 CACACACAGCACGGGAAGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 204
1164145399_1164145415 28 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145415 19:22509836-22509858 CCACACACAGCACGGGAAGAGGG 0: 1
1: 0
2: 1
3: 24
4: 196
1164145399_1164145413 27 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145413 19:22509835-22509857 TCCACACACAGCACGGGAAGAGG 0: 1
1: 0
2: 1
3: 13
4: 161
1164145399_1164145411 21 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145411 19:22509829-22509851 CCCATCTCCACACACAGCACGGG 0: 1
1: 0
2: 1
3: 40
4: 323
1164145399_1164145409 20 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145409 19:22509828-22509850 CCCCATCTCCACACACAGCACGG 0: 1
1: 0
2: 2
3: 44
4: 404
1164145399_1164145404 -6 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145404 19:22509802-22509824 TAAGTGCCTCCAGGAAGGGCAGG 0: 1
1: 1
2: 5
3: 27
4: 201
1164145399_1164145405 -5 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145405 19:22509803-22509825 AAGTGCCTCCAGGAAGGGCAGGG 0: 1
1: 1
2: 5
3: 33
4: 332
1164145399_1164145417 30 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145417 19:22509838-22509860 ACACACAGCACGGGAAGAGGGGG 0: 1
1: 0
2: 1
3: 30
4: 215
1164145399_1164145403 -10 Left 1164145399 19:22509785-22509807 CCAGGTTCCATCTGAGCTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1164145403 19:22509798-22509820 GAGCTAAGTGCCTCCAGGAAGGG 0: 1
1: 0
2: 1
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164145399 Original CRISPR CACTTAGCTCAGATGGAACC TGG (reversed) Intronic
900797910 1:4720481-4720503 ACCTTGGCTCAGATGGACCCAGG + Intronic
901873391 1:12151872-12151894 CACCTAGCCCAGATGGAGGCAGG + Intergenic
909735262 1:78951161-78951183 CTGTAAGCTGAGATGGAACCTGG - Intronic
1062969402 10:1634433-1634455 CTCTCAGCTCAGATGGTCCCTGG - Intronic
1065859380 10:29858706-29858728 GACTCAGTTCAGATGGACCCAGG - Intergenic
1067832045 10:49615937-49615959 CAATTAGCCCAGATGCATCCTGG + Intronic
1068037535 10:51779674-51779696 CATTTAGCTCTGATGGCACCTGG + Intronic
1072027818 10:91480092-91480114 CACTTAACTGAGATGTAACAGGG - Intronic
1072666056 10:97393286-97393308 CACTGAGCACACATGGAACCAGG + Intronic
1072773746 10:98167848-98167870 CACTTAGCTGAGATTGAGTCTGG + Intronic
1074513666 10:114143198-114143220 CTTTGAGCTCAGATGAAACCAGG - Intronic
1075685889 10:124364850-124364872 CCCTTTGCTCAGCTGGCACCTGG - Intergenic
1076303730 10:129448139-129448161 CACTTAGCACACATGGATCCTGG + Intergenic
1077296904 11:1830644-1830666 CACGTAGCTCAGCTGTACCCTGG + Intronic
1082080096 11:48006214-48006236 CACTTTCCTCATCTGGAACCTGG + Intronic
1094285612 12:28789734-28789756 CACTGAACTAAGATGGAACTGGG + Intergenic
1099387798 12:82038277-82038299 CACTTAGCTGAGTTTCAACCAGG + Intergenic
1105432602 13:20350905-20350927 CACGGAGCTGAGTTGGAACCTGG - Intergenic
1117680446 14:58198138-58198160 CAGTGAGCTGAGATCGAACCTGG + Intronic
1131593748 15:93775619-93775641 CACTTAGCTCAGTGGGAGACTGG + Intergenic
1132936283 16:2482951-2482973 CACTTGGCTCAGAAGGAAAACGG + Intronic
1134384363 16:13758153-13758175 CAGTAAGCTCTGAAGGAACCTGG - Intergenic
1134809329 16:17153965-17153987 GACAGAGCTGAGATGGAACCTGG - Intronic
1136519789 16:30787790-30787812 CTCATAGCTCAGAGGGCACCCGG + Intergenic
1137290295 16:47047955-47047977 CCCTGAGCTCAGAGGGCACCAGG - Intergenic
1140900156 16:79359723-79359745 CACTTACCTCAGAAGAAAGCTGG - Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1144124732 17:12192556-12192578 CACTGAGGTCAGATGCATCCTGG + Intergenic
1146272928 17:31496400-31496422 CTCTTAACCCAGATGGAACGGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148476152 17:47929991-47930013 CACAGATCTCAGATGGATCCAGG + Intergenic
1155146827 18:23091102-23091124 CAGTGAGCTGAGATGGCACCAGG - Intergenic
1156034141 18:32748156-32748178 CACTTAGAACAGCTGAAACCAGG - Intronic
1157283252 18:46359933-46359955 CACTTAGCTGCAAGGGAACCTGG + Intronic
1162060392 19:8091246-8091268 CACCTAGCTCAGAATGGACCAGG + Intronic
1163069622 19:14828231-14828253 CACTTCAATCAAATGGAACCAGG - Exonic
1163283442 19:16331284-16331306 CACTGAGCTGAGATGGCGCCTGG + Intergenic
1163894026 19:20041422-20041444 CACTGAGCACACATGGAACCAGG - Intergenic
1164145399 19:22509785-22509807 CACTTAGCTCAGATGGAACCTGG - Intronic
1164607508 19:29610716-29610738 CCCTTAGCTTAGGTGGAGCCAGG - Intronic
1167749341 19:51370545-51370567 CACTAAGCTCAGTTGGAATATGG - Intergenic
925916025 2:8606991-8607013 CACTGAGAACAGATGAAACCAGG + Intergenic
928528216 2:32163782-32163804 CACTGAGCTGAGATGAAGCCTGG - Intergenic
929960838 2:46495143-46495165 CTCTTATCTCAGGTGGATCCAGG - Intronic
931662692 2:64582324-64582346 CAGTCAGCTCAGAGTGAACCTGG + Intronic
931826850 2:66009377-66009399 CACTTTGCTCACAAGGAAACTGG + Intergenic
933985529 2:87589024-87589046 CACTGAGAACACATGGAACCAGG + Intergenic
943670557 2:190655789-190655811 CACTTAGCACAGTTGGAATCTGG + Intronic
946470942 2:219960444-219960466 CACTTATCTGAGGTGGAGCCTGG + Intergenic
947281209 2:228457267-228457289 CAGTTACCTCAGACTGAACCAGG - Intergenic
947543693 2:230995836-230995858 CAGGTAGCTCACATGGACCCAGG + Intergenic
948511027 2:238465447-238465469 CACATGGCTGTGATGGAACCAGG - Intergenic
948916267 2:241036270-241036292 CCCTAAGCTCAGATGCAAGCGGG - Intronic
948950028 2:241243460-241243482 CTTTTAGCTCAGTTGGAGCCTGG + Intronic
1175468514 20:59209082-59209104 CCCTTAGCTCAGATGCCACCGGG + Intronic
1178605157 21:34029865-34029887 CACGTAGCCCAGATGGAAGCGGG + Intergenic
1183591134 22:38779934-38779956 CACCTCCCTCAGATGTAACCTGG + Intronic
949419246 3:3848307-3848329 CATTTAGAGCAGATGGAACTAGG + Intronic
950378134 3:12588929-12588951 CTATTAGCTCACATGAAACCTGG + Intronic
952415272 3:33084347-33084369 CTCTTAGCTCTGATGTAATCAGG - Intronic
952821564 3:37490893-37490915 CACTTAGAGGAGCTGGAACCAGG - Intronic
954697247 3:52434472-52434494 CAGTTAGCTCAGAAGCCACCTGG - Exonic
959022653 3:101205374-101205396 GACTTTGCTCAGTTGGAACAGGG - Intergenic
961979221 3:131058830-131058852 CAGTTACCTCAGTTGTAACCAGG - Intronic
965550217 3:169957004-169957026 CACTTAGTTAAGATGGGATCTGG - Intergenic
967691508 3:192479352-192479374 CACCTGACTCAGATGGAGCCTGG - Intronic
970330972 4:14983362-14983384 CACTGAGCCCAGATGGTGCCTGG + Intergenic
970883829 4:20963726-20963748 AACTGAGCTCAGATGGATGCAGG + Intronic
974988389 4:69057628-69057650 CACTTTGCTCAGATAGATGCTGG - Intronic
980127042 4:128784256-128784278 CAGTGAGCTCAGATCGCACCAGG - Intergenic
982102720 4:151983990-151984012 CCCTTTGCTCAGATGGCACTGGG - Intergenic
989472600 5:41837810-41837832 CACACAGCTTAGGTGGAACCAGG - Intronic
992737596 5:79738968-79738990 CACTTGGCTCAGGTGGGACCAGG - Exonic
994658766 5:102627777-102627799 CATGGGGCTCAGATGGAACCTGG - Intergenic
996284244 5:121770026-121770048 TCCTTAGCTCAGAGGGTACCAGG + Intergenic
997413011 5:133704473-133704495 CATTCAGCTCAGATTGAACTAGG + Intergenic
997481466 5:134188262-134188284 CACTCAGCTCAGCTGGTGCCTGG + Intronic
1006411435 6:33876213-33876235 CCCTTAGGTCAGCTGGGACCAGG - Intergenic
1008970579 6:57362927-57362949 AACTTAGCTCATAGGGAAACCGG + Intronic
1009159548 6:60264752-60264774 AACTTAGCTCATAGGGAAACTGG + Intergenic
1011166173 6:84449395-84449417 CACTTAGTTCAGCTGAAACGGGG + Intergenic
1012184391 6:96194896-96194918 CACTGAGCCCAAATGTAACCTGG - Intronic
1012314304 6:97766748-97766770 CTCTCAGCTCTGATTGAACCTGG - Intergenic
1013301522 6:108808972-108808994 CATTTAGCCCAGGTGGTACCCGG + Intergenic
1016534360 6:145093749-145093771 ATCTTTGCTCAGATGGAAACCGG + Intergenic
1020228483 7:6298716-6298738 CAGTGAGCTGAGATGGAGCCTGG - Intergenic
1022445347 7:30465933-30465955 CACCCAGGTCATATGGAACCTGG + Intronic
1024063654 7:45716269-45716291 CAGCCAGCTCAGATGGACCCTGG - Exonic
1026597585 7:71746870-71746892 CAGTAAGCTGAGATGGCACCAGG + Intergenic
1027999938 7:85480983-85481005 TACTAAGCTCAGAGGTAACCTGG + Intergenic
1034939533 7:155221261-155221283 CAGTGAGCTCAGGGGGAACCAGG - Intergenic
1037581126 8:20246638-20246660 CACTGAGCTCACATGGGACTGGG - Exonic
1037884996 8:22591300-22591322 CACTGAGCACAGATGGCCCCAGG + Intronic
1039747351 8:40441043-40441065 CACTGAGCTTATATGTAACCTGG + Intergenic
1042736940 8:72000148-72000170 CACTTAGTTCAGATGTCACTGGG - Intronic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1049148709 8:141020619-141020641 CACTTTACTCACGTGGAACCAGG + Intergenic
1049609030 8:143544279-143544301 CACCTAGCCCAGATGGATCTAGG + Intergenic
1051177504 9:14375731-14375753 CACTTAGCTGCAAGGGAACCTGG + Intronic
1053427182 9:38017784-38017806 CACTGAGCTCAAATGACACCAGG + Intronic
1187007183 X:15244026-15244048 CATATAGCAGAGATGGAACCAGG + Exonic
1188989266 X:36797887-36797909 TACTTAGGTCATATGTAACCAGG - Intergenic
1189643853 X:43104889-43104911 CACTTAGCTGAACTGCAACCAGG + Intergenic
1190217879 X:48492321-48492343 CCCTTAGCTCTGCTGAAACCTGG - Intergenic
1193174774 X:78379732-78379754 CACTTAGCTCAGAATGATCAGGG + Intergenic
1194970394 X:100337006-100337028 TACTTAGCTCAGAGATAACCCGG + Intronic
1195578964 X:106480335-106480357 CACTTCACTCAGATGGACCATGG + Intergenic