ID: 1164146052

View in Genome Browser
Species Human (GRCh38)
Location 19:22513227-22513249
Sequence GCTGGGGAGCCTCGGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 487}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164146052_1164146064 22 Left 1164146052 19:22513227-22513249 CCCCTTCCCCGAGGCTCCCCAGC 0: 1
1: 0
2: 3
3: 50
4: 487
Right 1164146064 19:22513272-22513294 ACCCACAGCTCAAAGTTCTGTGG 0: 1
1: 1
2: 1
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164146052 Original CRISPR GCTGGGGAGCCTCGGGGAAG GGG (reversed) Intronic
900163712 1:1236452-1236474 GCTGGGGAGCCTGGGGCCGGTGG - Intergenic
900182109 1:1315710-1315732 GGTGGGGAGCGTGGGGGAAGGGG + Intronic
900395605 1:2452079-2452101 GCAAGGGAGCCTCGGGCCAGAGG - Intronic
900438303 1:2641628-2641650 GCTGCTGAGCCTGGGGGATGAGG - Exonic
901011995 1:6207323-6207345 GGTGGGGAGCCCTGGGGAAGGGG + Intronic
901040245 1:6359151-6359173 GCTGAGCGGCCTCAGGGAAGCGG + Intronic
901119422 1:6878663-6878685 GCTGGGGATCCTTGGGGGAGCGG - Intronic
902035930 1:13458070-13458092 GCTTGGGAGGCTGGGGCAAGAGG + Intergenic
902715594 1:18270454-18270476 CCAGGGCAGCCTCGGGCAAGAGG + Intronic
903435299 1:23344518-23344540 GCTGGGGCGCCTCCGGGGCGGGG + Intergenic
903557177 1:24202518-24202540 GCTTGGGAGCATCGTGGAACAGG - Intergenic
903774007 1:25781499-25781521 GCTGGGCTGCCTGTGGGAAGAGG - Intronic
903945400 1:26959710-26959732 CCTGGGGACCCTCGGAGGAGGGG - Intronic
904207612 1:28864988-28865010 CCTGGGGAGCCTGGGGGGAAAGG - Intergenic
905621860 1:39455288-39455310 CCTGGGGAGACTCCAGGAAGAGG - Intronic
906204557 1:43979816-43979838 GGTGTGGAGCCTGGGGGCAGGGG - Intronic
906209991 1:44007413-44007435 GCTGGGGAACCCCTGGGCAGAGG - Intronic
906546026 1:46620054-46620076 GCTGGGGAGTCCCCAGGAAGTGG - Intergenic
906805508 1:48776374-48776396 GCGCGGGAGCTTCGGGGAAGCGG + Intronic
907051423 1:51331827-51331849 ACTGGGGAGCTTCCTGGAAGAGG + Intronic
907270500 1:53288220-53288242 GCTGGGCAGCCTTGGGCAAGGGG + Intronic
908498151 1:64716003-64716025 ACTTGGGAGGCTAGGGGAAGAGG - Intergenic
912383571 1:109260444-109260466 GCTGGGGAGCCCCCAGGAATGGG - Intronic
912494773 1:110084376-110084398 GCTGGGGGGCCTCGGGGCTCAGG + Intergenic
912716625 1:111988275-111988297 GCTGGGGATCCTTGGGGGACAGG + Intronic
912717141 1:111990468-111990490 GCTGGGGACCCACGGAGAGGTGG + Intergenic
915228823 1:154430644-154430666 TCTGGGGGGCCTCGGGAAGGAGG - Intronic
915458197 1:156053993-156054015 CCTGGGGGGCCTCTGGGAGGGGG + Intergenic
915568702 1:156732083-156732105 GCTGGGGATGCCTGGGGAAGGGG + Exonic
916478429 1:165192571-165192593 GCTGGGGAGACTCAGAGATGAGG - Intergenic
916610770 1:166389314-166389336 ACTGGGGAGGCTAGGGGAAATGG - Intergenic
918322652 1:183379287-183379309 GCTGGGGAGGCTCAGGCAGGAGG - Intronic
918950109 1:191125986-191126008 GATGGGGAGCCTTGGGGGATAGG - Intergenic
919878901 1:201889357-201889379 GCTGGGGACCGCCGGGGGAGTGG + Intronic
919929734 1:202213559-202213581 GCTGGGGAGGCTGTGGGTAGAGG - Intronic
921213540 1:212919204-212919226 GCTCGGGAGCCTTGGGGACTGGG - Intergenic
922061117 1:222092954-222092976 TCAGGGGAGCCTCAGGAAAGAGG + Intergenic
922207505 1:223461362-223461384 GCTGGGGTGCCTTGGGAAGGAGG - Intergenic
922811256 1:228416700-228416722 GCTGGGGGGCGGCGGGGGAGGGG + Intronic
924003684 1:239582949-239582971 GCTGGAGAGCAACAGGGAAGAGG - Intronic
924009057 1:239644367-239644389 GCTGAGGACCCTGGGGGAACAGG - Intronic
924068838 1:240254817-240254839 TCAGGGGAGCCCCGGGGATGTGG + Intronic
924265952 1:242282286-242282308 GCTGTGCAACCTCGGGCAAGAGG - Intronic
1062839903 10:662034-662056 GCTGTGGAGCCACGGGGGACAGG - Intronic
1062975568 10:1680037-1680059 GCTGGGGAGGCCTGGGGGAGTGG - Intronic
1063266665 10:4459004-4459026 GCTTGGGAGCTTCGGGGGTGCGG - Intergenic
1064038571 10:11937102-11937124 GCTGGGGAGCCCTGGAGAAAGGG - Intronic
1064943444 10:20760557-20760579 GCTTGGGAGTCTCAGGCAAGTGG - Intergenic
1066272042 10:33833718-33833740 GCTGGTAAGCCCCTGGGAAGAGG + Intergenic
1066718882 10:38316250-38316272 GCTGTGCAACCTCGGGCAAGAGG + Intergenic
1066718892 10:38316356-38316378 GCTGTGCAACCTCGGGCAAGAGG + Intergenic
1067711892 10:48656433-48656455 CCTGGCGGGCCTCGGGGAGGCGG + Intergenic
1068562491 10:58531030-58531052 GCTGTGGTGGCTTGGGGAAGGGG - Intronic
1069641790 10:69961148-69961170 GCTGGGAAGCCCAGGGGATGGGG + Intronic
1069822777 10:71237872-71237894 CCAGGTGAGCCTGGGGGAAGAGG + Intronic
1069854870 10:71434579-71434601 GCTGGGGAGGCTCTGAGAGGTGG - Intronic
1069885675 10:71622159-71622181 TCTGGGGAGCCACGGTGAATCGG + Intronic
1070453096 10:76581488-76581510 GCTGGGGAGGGTCGGGGAGGTGG + Intergenic
1070768044 10:79067621-79067643 GGTGGGGGGCCTCGAGGAAGGGG + Intergenic
1071412083 10:85407017-85407039 GAAGTCGAGCCTCGGGGAAGTGG - Intergenic
1071529347 10:86377169-86377191 GCTGGAGAACCTCATGGAAGAGG + Intergenic
1072631389 10:97149242-97149264 GCACGGGAGTCTCCGGGAAGAGG - Intronic
1073206510 10:101772240-101772262 ACTGGGAAGCCACAGGGAAGAGG - Intronic
1073253939 10:102139158-102139180 GCTAGGAAGCTTGGGGGAAGAGG - Exonic
1074836015 10:117294850-117294872 GCTGGGGAGAATAGGGGGAGTGG + Intronic
1075587504 10:123668141-123668163 CCAGGGGAGCCTCGGGGCAGAGG + Intronic
1075711688 10:124534058-124534080 GGTGGGGAGCTTGGGGGCAGTGG + Intronic
1076109407 10:127849437-127849459 GCTGGGGAGGCACGGACAAGGGG + Intergenic
1076632737 10:131861201-131861223 GCTGAGGTGCCTTGGAGAAGAGG + Intergenic
1076732075 10:132444125-132444147 GGTGGGGAGCCCTGAGGAAGGGG - Intergenic
1076751034 10:132543235-132543257 GGTGGGGAGGCTGGGGGACGTGG - Intronic
1077063499 11:627473-627495 ACTGGGGGGCCCCGGGGAAGGGG + Intergenic
1077117372 11:891276-891298 GGTGGGGGTCCCCGGGGAAGTGG - Intronic
1077219510 11:1409466-1409488 GCAGGGGAGCCCCGGTGAACTGG - Intronic
1077231999 11:1461914-1461936 TCTGGGGGGGCTCGGGGCAGAGG + Intronic
1077264170 11:1640830-1640852 GAGTGGGAGCCTCAGGGAAGGGG + Intergenic
1077385576 11:2268095-2268117 GCTGGGCAGCCCAGGGCAAGTGG - Intergenic
1078859850 11:15236789-15236811 GCAGGGAAGCCTGGGAGAAGGGG - Intronic
1079988851 11:27226133-27226155 GCTGTGGCATCTCGGGGAAGGGG - Intergenic
1081770552 11:45648174-45648196 GGTGGGGTGCCTCAGGGCAGTGG - Intergenic
1083603838 11:63965157-63965179 GGTGGGGACCCCAGGGGAAGAGG - Intergenic
1083723990 11:64618964-64618986 CCTGTGGAGCCTTGGGGCAGAGG - Intronic
1083744411 11:64727221-64727243 GCTGGGGAGTATCAGGGAAATGG - Intronic
1083755392 11:64789297-64789319 ACTGGGCTGCCTCGGGGATGGGG + Exonic
1084515721 11:69637190-69637212 GCTGGAGAGGCGCGGGGATGCGG + Intergenic
1084588293 11:70076093-70076115 CCTGGGAAGACTTGGGGAAGGGG + Intergenic
1084717652 11:70883802-70883824 GCTGGGGAGGCCCAGGCAAGGGG + Intronic
1084954975 11:72686191-72686213 GCTGGGGAGCAGAGAGGAAGGGG + Exonic
1085039585 11:73319001-73319023 GCTGGGGAAGATGGGGGAAGGGG - Intronic
1085201686 11:74705841-74705863 TCTGGGGAATCTCTGGGAAGGGG + Intronic
1085296699 11:75435446-75435468 GCTGGGGAGCCTAGGAGAGCTGG - Exonic
1086810595 11:91305558-91305580 GCTAAGGATCCTCGGGGGAGGGG - Intergenic
1089459773 11:118645713-118645735 GCTGGGGAGAGAAGGGGAAGAGG - Exonic
1089621997 11:119727734-119727756 GCGGGGCACCCTCGGGAAAGTGG + Intronic
1089630209 11:119779672-119779694 GCTCGGGTGCCTCGGGTGAGAGG - Intergenic
1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG + Intergenic
1089773526 11:120819995-120820017 GCTGGAGACCCTCCAGGAAGGGG + Intronic
1089973157 11:122710707-122710729 GCTGGGGAGAATTGGGGAGGGGG + Intronic
1090208400 11:124898261-124898283 GCTGGGGAGGCTGAGTGAAGTGG + Exonic
1090420773 11:126573454-126573476 GCTGGGGTGGGTGGGGGAAGCGG - Intronic
1091042177 11:132291989-132292011 GCTGTGGAGCCTGGGGTCAGTGG + Intronic
1091206221 11:133823141-133823163 ACTGGGGACCCTGGGGTAAGTGG - Intergenic
1091473752 12:752866-752888 GCGGGGAGGCCTCGGGGAAGGGG + Intronic
1091703241 12:2677675-2677697 GCTGGGGAGCTTGGAGGAAAGGG + Intronic
1092523879 12:9297875-9297897 GCTGTGTACCCTTGGGGAAGAGG + Intergenic
1092543419 12:9434024-9434046 GCTGTGCACCCTTGGGGAAGAGG - Intergenic
1092941346 12:13410175-13410197 GCTGGGCAGAATGGGGGAAGAGG - Intergenic
1094296651 12:28914650-28914672 GATGGAGAGCCTCGGGGGATGGG - Intergenic
1095743197 12:45629053-45629075 GCTTGGGAGCCTGGGGCAGGAGG + Intergenic
1096337148 12:50764760-50764782 GCTGGCGACCCTGAGGGAAGAGG + Intronic
1096435595 12:51588917-51588939 ACTCGGGAGGCTCGGGCAAGAGG - Intergenic
1096729160 12:53593159-53593181 ACTTGGGAGCCTCGGGTGAGAGG + Intronic
1097682261 12:62659841-62659863 GGTGGGAAGCCTGAGGGAAGGGG - Intronic
1097697734 12:62790687-62790709 ACTGGAGAGCCACGGGGAGGAGG + Intronic
1099195067 12:79606186-79606208 GCTGGGGGACCTAGGGGCAGAGG + Intronic
1101310059 12:103569772-103569794 GCTGGGGTGGCTCTGGGCAGAGG + Intergenic
1101940766 12:109097779-109097801 GCTGGGGTGCCTGAGGAAAGCGG + Exonic
1103272361 12:119684059-119684081 GCTGGGGAGGGTGGGGGTAGTGG - Intergenic
1103606428 12:122089071-122089093 GCTGGGGAGGCTGGGGCAAAAGG + Intronic
1104038439 12:125114452-125114474 GCAGGGGAGACACGGGGGAGCGG - Intronic
1104581436 12:130014017-130014039 GCAGGGAAGCCTCCGGAAAGAGG + Intergenic
1104662336 12:130620336-130620358 GATTGGGAGCCTCAGGGAGGAGG - Intronic
1104987245 12:132603979-132604001 CCTGCGGAGCCGCGGGGAGGGGG - Intronic
1105941751 13:25153820-25153842 GCTGGGCAGCCTAGGGGGAAGGG - Intergenic
1106023980 13:25940224-25940246 GCTGAAGAGCCACCGGGAAGGGG - Intronic
1106101473 13:26697528-26697550 GCTGGGGAGTGTCGGGGAACAGG + Intergenic
1107632132 13:42353089-42353111 GCTTAGAAGCCTTGGGGAAGGGG - Intergenic
1107950168 13:45454300-45454322 CCTGGGCAGCCTCGGAGGAGGGG + Intergenic
1109022799 13:57119491-57119513 GCTGGGCAGCCTGGGGTTAGGGG + Intergenic
1110469691 13:75844933-75844955 CCTGGGGAGTGTGGGGGAAGTGG + Intronic
1113484817 13:110646081-110646103 GCTGGAGAGCCTGAGGGAAGAGG + Exonic
1113640662 13:111954720-111954742 GCTGGGAGGCCTAGGGGGAGGGG - Intergenic
1114416921 14:22551110-22551132 ACTGGGGACCCTGGGGGAGGAGG - Intergenic
1114674722 14:24432316-24432338 GCTGGGCACCCTCGGAGGAGAGG - Exonic
1117511035 14:56451002-56451024 GCTGGGGAGACTGAGGGAAAGGG + Intergenic
1117647171 14:57865279-57865301 GCTGGGGAGGCTCGGGGGTGGGG - Intronic
1117647275 14:57865649-57865671 GCAGGGGTGCCGCGGGGATGCGG - Intronic
1117950728 14:61080641-61080663 GCTGGGGAGCCTAGGGAATTTGG - Intronic
1118166538 14:63341695-63341717 GCAGGGGAGTTTGGGGGAAGAGG + Intergenic
1118867292 14:69713408-69713430 GCCCAGGAGCCTCTGGGAAGTGG - Exonic
1119385917 14:74258126-74258148 GTTGGGGGTCCCCGGGGAAGCGG + Intronic
1119435473 14:74595264-74595286 GCTGGGGAGCCGCGGGGCCAGGG + Intronic
1119797422 14:77411634-77411656 GGTGGAGAGCTTCAGGGAAGTGG + Intronic
1120163481 14:81170072-81170094 GATGGGGAGCCTTGGGGGATAGG - Intergenic
1120789702 14:88568385-88568407 GCTGGGGAGGCCCCAGGAAGGGG + Intronic
1121623942 14:95371240-95371262 GCTGGGGAGCCGGAGGGAAGAGG - Intergenic
1122272163 14:100573208-100573230 GCTGGTGAGTCTGGGGGGAGGGG + Intronic
1122272179 14:100573246-100573268 GCTGGTGAGTCTGGGGGGAGGGG + Intronic
1122788541 14:104174910-104174932 TCTGGGGAGGGTCGGGGAAGCGG + Intronic
1122808496 14:104275542-104275564 GCTGGCGAGCCGGGGAGAAGAGG - Intergenic
1122894423 14:104749244-104749266 GAGGGGGAGCCACGGGGAACAGG - Intergenic
1123709096 15:22973530-22973552 GCTGGGGTGGCTGGCGGAAGGGG - Intronic
1124208577 15:27743831-27743853 GCTGGCTGGCCTCGGGGCAGGGG - Intergenic
1124238009 15:28006010-28006032 GCTGGGGAACTTTGGGCAAGTGG + Intronic
1124389666 15:29242791-29242813 GCTGGGGAGCCCCTTGGACGAGG + Intronic
1124578476 15:30930274-30930296 GCTGGGGAGCGCTGAGGAAGAGG - Intronic
1124974738 15:34521780-34521802 GCTGGGGAGCCTTGGGGCCATGG - Intergenic
1125518310 15:40335120-40335142 GCTGGGGAGTCCCCGGGGAGAGG - Exonic
1125521016 15:40347881-40347903 GCTCGGCACCCTGGGGGAAGAGG + Intergenic
1125540130 15:40465465-40465487 CCTGGGGAGCCTGAGGGAAGAGG - Intronic
1127456589 15:59161014-59161036 GCTCGGGAGACTCGGGGGAGCGG + Intronic
1128459918 15:67859344-67859366 GCTGGGGAGCCTGAGGCAGGAGG + Intergenic
1128546822 15:68573996-68574018 GATGGGAAGCCTGGGGGATGGGG + Intergenic
1129108259 15:73323272-73323294 GCTGGGCAGCCTGCGGGGAGCGG + Exonic
1129264691 15:74387383-74387405 GGCTGGGAGCCTCGGGGAAGCGG + Intergenic
1130042960 15:80419972-80419994 GTTGGGGAGCCTGGGGCAATGGG + Intronic
1130612493 15:85374006-85374028 GCTGGGGAGCCTCTGGGGGCAGG + Intergenic
1132279813 15:100602841-100602863 GCCGGGCAGCCTTGGGGCAGAGG - Exonic
1132478601 16:154441-154463 GCTGGGGAACCTCCAGGACGGGG - Exonic
1132719151 16:1307448-1307470 GCTGGGGACCCTGTGGGAGGTGG + Intergenic
1132731375 16:1363872-1363894 GCTGGGGAGCCCCAGGGGTGGGG - Exonic
1132774629 16:1586192-1586214 CCTGGGCAGCCCCGGGGCAGAGG - Exonic
1132813021 16:1810759-1810781 GGTGGGGAACCTCGGGGGTGAGG - Intronic
1132854590 16:2039103-2039125 GCTGCTGAGACTCGGGGAGGGGG - Intergenic
1132946866 16:2536597-2536619 GTGGAGGAGCCTCGGGGCAGGGG - Intergenic
1132968792 16:2674712-2674734 GTGGAGGAGCCTCGGGGCAGGGG + Intergenic
1133039551 16:3053067-3053089 GCTGGGGAGCCTGAGTGACGGGG + Intronic
1133043394 16:3072700-3072722 GCTGGGGAGCCTGAGTGACGGGG + Intronic
1133212436 16:4271189-4271211 GGTGGGGACCCCCGGGGCAGAGG + Intronic
1134126955 16:11622423-11622445 GCTGGAGAGCCCCCGGGAAGAGG + Intronic
1135662280 16:24307024-24307046 TGTGGGAAGCCTCTGGGAAGCGG - Intronic
1136021978 16:27446151-27446173 GCTGGGGAGCCTGGGGTGAGGGG - Intronic
1136141719 16:28292772-28292794 TCCGGCGAGCCTCGGGGAAGAGG + Exonic
1136516156 16:30769528-30769550 GCAGGGCAGCCTCGGGGGTGTGG + Exonic
1137323522 16:47410868-47410890 GATGGAGAGCCTTGGGGAATGGG - Intronic
1137939118 16:52665226-52665248 GCTGGGAAGAGTGGGGGAAGGGG + Intergenic
1138574675 16:57900162-57900184 GCTGTGCAGCCTTGGGCAAGTGG - Intronic
1138585046 16:57964050-57964072 GCTAGGGAGCCCTGGGGATGGGG - Intronic
1138618928 16:58197139-58197161 GCTGGGGAGCCGCGGGGCACAGG - Intronic
1138928373 16:61619877-61619899 GCTGGAGAGCCTCAGTGAAGAGG + Intergenic
1139371937 16:66474405-66474427 GATGGGGAGCCATTGGGAAGTGG - Intronic
1139834936 16:69830629-69830651 GTTGGGGGGCCGCGGGGAGGTGG + Intronic
1140252370 16:73305243-73305265 CCAGGGGAGCCTGGAGGAAGGGG + Intergenic
1140574329 16:76147939-76147961 TGTGGGCAGCCTCTGGGAAGCGG + Intergenic
1141575255 16:84959299-84959321 GCTGGGGTGACTCGGGCAGGGGG + Intergenic
1141812221 16:86383253-86383275 GCTGGGGAGCCGGGAGGATGTGG - Intergenic
1141828912 16:86498674-86498696 GCTGGGGGGCCTCGGGGCACCGG - Intergenic
1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG + Intronic
1142030172 16:87834644-87834666 GCTGAGGAACCTCGGGGCATGGG - Intronic
1142153554 16:88523228-88523250 ACTGGGGAGCAAGGGGGAAGGGG - Intronic
1142376011 16:89707491-89707513 CCTGGGGAGCATCAGGGAAGAGG - Exonic
1142502359 17:340137-340159 GCTGGGGAGCCTGGAGCCAGGGG - Intronic
1142664584 17:1455638-1455660 GGAGGGCAGCCGCGGGGAAGGGG - Intronic
1142709612 17:1715989-1716011 GCAGGGGCGCCTCGGGGAGAGGG - Intergenic
1142716673 17:1750875-1750897 AAAGGGGAGCCTCGGGGAGGTGG - Intronic
1142903968 17:3030830-3030852 GCTAGGGAGGCCAGGGGAAGGGG - Intronic
1143155654 17:4834308-4834330 GCTGGGAGCCCTCGGGGAGGAGG + Intronic
1143512294 17:7403582-7403604 TCTGGGGTCCCTGGGGGAAGTGG - Intronic
1143758807 17:9086257-9086279 GCTGGGGAGCCTGAGGCAGGAGG + Intronic
1144761433 17:17709667-17709689 GCTGCTGGGCCTCGGGGAGGGGG + Intronic
1144867180 17:18344007-18344029 TCTGAGAAGCCTCAGGGAAGAGG + Intronic
1145250918 17:21296602-21296624 GCTGTGCAGCCTGGGGCAAGTGG + Intronic
1145285827 17:21505524-21505546 GCTGGGGTGACTAGGGGAGGAGG + Intergenic
1146009130 17:29180082-29180104 GATCGGGAGCGGCGGGGAAGGGG - Intronic
1147163242 17:38579728-38579750 GCTGGAGAGCATTTGGGAAGGGG - Intronic
1147428444 17:40357208-40357230 GCTGGGGAGCCTAGATGATGTGG - Intronic
1147455694 17:40536783-40536805 GCTGGAGAGCCTCAGGGAGAAGG - Intergenic
1147976871 17:44252982-44253004 GCTGGGGAGATGTGGGGAAGTGG + Intronic
1147981923 17:44280117-44280139 GCTGGGGAGCCCTGTGGAGGAGG + Intergenic
1148086899 17:44999144-44999166 GGTGGGGAACTACGGGGAAGAGG - Intergenic
1148145719 17:45363556-45363578 GCTGGGTATCCCAGGGGAAGAGG - Intergenic
1148175128 17:45557323-45557345 CCTTGGGATCCTGGGGGAAGAGG + Intergenic
1148296243 17:46505704-46505726 CCTTGGGATCCTGGGGGAAGAGG - Intergenic
1148323587 17:46771355-46771377 CTGGGGGCGCCTCGGGGAAGAGG + Intronic
1148766808 17:50044324-50044346 GATGGGGAGGCAGGGGGAAGTGG - Intergenic
1148774529 17:50088117-50088139 GCTGGGGAGCCTGGGGGCTGGGG - Intronic
1148863714 17:50617940-50617962 GGTGGGGGGCCTCTGGGGAGGGG + Intronic
1150692262 17:67377100-67377122 GCTGGGGAGGCTCGGGCAGAGGG - Intergenic
1151803910 17:76393644-76393666 GCTGGTGAGGCCTGGGGAAGGGG + Intronic
1151944304 17:77311188-77311210 GCCAGGGAGCGTCTGGGAAGAGG + Intronic
1152181214 17:78822917-78822939 GCTGGAGAGCCTGGGGAGAGGGG - Intronic
1152279231 17:79375615-79375637 GCTGAGCAGACTCGGGCAAGTGG + Intronic
1152475257 17:80513748-80513770 GCTGGGAGGCCTGGGGCAAGTGG + Intergenic
1152628462 17:81399211-81399233 GCTAGGGCGCCGCGGCGAAGAGG - Intronic
1153424005 18:4943383-4943405 CCTGGGGAGCCTGGGAGAAATGG - Intergenic
1154140791 18:11822359-11822381 GCTCGGGAGCCTGAGGGCAGAGG + Intronic
1155007418 18:21741267-21741289 GCCGGGGAGCCCGGAGGAAGCGG + Intronic
1155464528 18:26120426-26120448 GATGGAGTGCCTGGGGGAAGAGG + Intergenic
1156481658 18:37440219-37440241 GCTGGGGGGCCTCGGTGAGGGGG + Intronic
1157613902 18:48975860-48975882 GCCGGGGAGGCAGGGGGAAGGGG + Intergenic
1158574972 18:58629123-58629145 GCTGGGGAGGCCCTGGCAAGGGG + Intergenic
1158882242 18:61791616-61791638 GCAGGGGAGGGTCTGGGAAGAGG - Intergenic
1159238293 18:65706575-65706597 GCAGCAGAGCCTCAGGGAAGGGG - Intergenic
1159700218 18:71617274-71617296 TCTGGGGAGGCTGGGGCAAGAGG - Intergenic
1159960971 18:74555511-74555533 TCTGGGGGGCCTCTGTGAAGGGG + Intronic
1160145585 18:76361481-76361503 GCTGGGGTGGCTCAGGGAAGGGG + Exonic
1160317076 18:77858432-77858454 CCTGGGGACCCTCTGGGATGGGG + Intergenic
1160844896 19:1161894-1161916 CCTGGGGAGCCGCGGGGGGGGGG + Intronic
1160863944 19:1249160-1249182 GCGGGCGCGCCTCGGGGAAACGG + Intronic
1160978465 19:1805847-1805869 GCTGGGGACCCTGGGGGGTGGGG - Intronic
1160978670 19:1806588-1806610 GCTGGGGATCCGCGGGGACACGG - Intronic
1161327271 19:3669949-3669971 GGTCAGGAGCCTCGGGGCAGGGG + Intronic
1161594151 19:5142648-5142670 CCTGGGGAGCCTGGGGGTGGGGG - Intronic
1161707773 19:5830073-5830095 GCAGGGGAGCTTCGGGGGGGCGG - Intergenic
1161731713 19:5964808-5964830 ACAGGGCAGCCTGGGGGAAGAGG + Intronic
1161731763 19:5965028-5965050 GGTGGGGATCCTGGTGGAAGGGG + Intronic
1161771941 19:6235643-6235665 GCTGAGGAGCTTGGGAGAAGCGG - Intronic
1162406803 19:10479653-10479675 GCTGGGGAGCCTTGAGGAAGGGG - Intergenic
1162567872 19:11454113-11454135 GCTGGGGAGGCCTGGGCAAGGGG + Exonic
1162778382 19:12993946-12993968 GCTGGGGACCCTGGAGCAAGGGG - Intergenic
1162910082 19:13843591-13843613 GCCGGGAAGCCTAGGGGGAGGGG - Intergenic
1163164777 19:15488498-15488520 GCTGGGGAGGCTGGGGCAGGCGG - Intronic
1163262906 19:16201937-16201959 GCCGGGGAGGCTGGGGTAAGTGG + Intronic
1164146052 19:22513227-22513249 GCTGGGGAGCCTCGGGGAAGGGG - Intronic
1165377159 19:35450750-35450772 GCTGGGAAGCCTGGGAGAGGCGG + Exonic
1166377731 19:42337037-42337059 GCTGGCAAGCCTAGGGGAGGTGG - Intronic
1167414362 19:49362386-49362408 GCTGGGGAGCCGCGGGCGGGCGG + Intronic
1167509165 19:49887341-49887363 GCTGGGGAACCTCGGAGGTGAGG - Intronic
1167574598 19:50312075-50312097 GTGGGGGAGGCTTGGGGAAGGGG + Intronic
1167669138 19:50839457-50839479 GCTGGGGAGTCTGAGGGAGGAGG + Intergenic
1167693588 19:51001683-51001705 CCTGGGGAGCTTCTGGGAACTGG + Intronic
1167748668 19:51367388-51367410 GCTGGGGAGCCTCTGGGGTGAGG + Intronic
1168130134 19:54312510-54312532 GATTGGAAGCCTCAGGGAAGGGG - Intronic
1168266331 19:55225628-55225650 GGTGGGGAGCCTGGAGGACGGGG - Intergenic
925046521 2:777128-777150 GCTGGGAAGCGTCCGGGATGGGG - Intergenic
925097656 2:1220185-1220207 GCTGTGGGGCCTCAGGAAAGGGG + Intronic
926283384 2:11468193-11468215 GCTGGGGAGAGTCGGGGAAATGG + Intergenic
926336072 2:11863848-11863870 GGTGGGGAGACTGGGGGAGGCGG - Intergenic
927244471 2:20945917-20945939 ACTGAGGGGCCTGGGGGAAGAGG - Intergenic
927751902 2:25676798-25676820 GGTGTGGAGCCAAGGGGAAGTGG - Intergenic
927989162 2:27435251-27435273 GCAGGGGAGCCTCGGGAATTTGG + Intronic
928158455 2:28897894-28897916 TCTTTGGAGCCTGGGGGAAGAGG + Intronic
929432169 2:41896522-41896544 GCTTGGAAGCCCCTGGGAAGAGG + Intergenic
929919649 2:46163212-46163234 ACTGGAGAGCCATGGGGAAGTGG + Intronic
930055597 2:47249821-47249843 GGTGGGGAGGCACAGGGAAGAGG - Intergenic
931323284 2:61193699-61193721 CCTGGGGACCCTAGGGGATGTGG - Intronic
931447025 2:62335312-62335334 GTTGGGAAACCTCTGGGAAGGGG + Intergenic
932308010 2:70717526-70717548 GTTGGGGAGCACCTGGGAAGTGG - Intronic
932723212 2:74154305-74154327 GCTAGGGAGCCAAGGGGAGGAGG - Exonic
932767096 2:74477616-74477638 GCTGGGAAGCCTCAGAGGAGTGG - Intronic
934778471 2:96953922-96953944 GCTGGGAAGCCTGGAGGAAAAGG + Intronic
936518167 2:113195681-113195703 GCAGGGGAGCCTCAGGGCTGTGG - Intronic
936713857 2:115162242-115162264 GGTGGAGAGCCGCGGGGAAGGGG + Intronic
937329779 2:121019250-121019272 GCTGGAGCGCCTCAGGGCAGGGG - Intergenic
937899959 2:127012277-127012299 GCTGGGGAGTGGCAGGGAAGAGG + Intergenic
939883497 2:147656237-147656259 GCTGTGGGGCCTTGGGCAAGAGG + Intergenic
940851426 2:158691049-158691071 GCTGGGGAGCACAGGGAAAGAGG + Intergenic
941838092 2:170048252-170048274 GCTGGTCAGCTTTGGGGAAGGGG - Intronic
942077876 2:172373571-172373593 GCTTGGGGGCCTTGGGGAAAAGG - Intergenic
943897649 2:193386286-193386308 GTTGGGGAGTCTGGGGCAAGGGG + Intergenic
946322457 2:218961728-218961750 GCTGGGGGGTGTGGGGGAAGGGG + Exonic
946617892 2:221529305-221529327 GCTGGAGAGGCTGGGAGAAGGGG + Intronic
946703372 2:222434477-222434499 GCTTGGGAGTCTTGGGAAAGGGG + Intronic
947559263 2:231132597-231132619 GCTGGGGAGAGTCGGTGGAGTGG - Intronic
947650232 2:231780804-231780826 ACGGGGGAGCCTGGGGGACGGGG - Intronic
948381038 2:237550208-237550230 GGTGGAGAGCCCCGGGGGAGAGG - Intronic
948423638 2:237875199-237875221 TCAGGGCAGCCTTGGGGAAGGGG - Intronic
948479262 2:238239984-238240006 GCTGGGCGGCCGCGGGGCAGCGG - Exonic
948493158 2:238326909-238326931 GCTGGGGAGCCTAGGGACAGAGG - Intronic
1169067277 20:2701228-2701250 TCTGGGCTGCCTCGGGGCAGTGG + Intronic
1169119122 20:3084794-3084816 CCTGGGGAGCCACTGGGGAGGGG - Intergenic
1169199123 20:3699129-3699151 GCTGGGGGGCCTAGAGGAGGTGG + Intronic
1169838600 20:9908637-9908659 GATGGGGGTCCTGGGGGAAGTGG - Intergenic
1170632076 20:18074363-18074385 ACTGAGGAGCCTCAGGCAAGGGG - Intergenic
1171037738 20:21729364-21729386 GCTGGGGAGGAGCGGGGAGGAGG + Intergenic
1171445899 20:25204795-25204817 GCTGGGGAGGCCTGGGGCAGGGG + Intronic
1171893769 20:30742065-30742087 GCCTGAGAGCCTTGGGGAAGCGG + Intergenic
1172425584 20:34853793-34853815 GCTGTGCAGCCTTGGGCAAGTGG - Intronic
1172482156 20:35277594-35277616 TCTGGGGAGCCTCGGGTGGGAGG + Intergenic
1172627818 20:36358297-36358319 GCTGGGGAGCCACGAGGACGGGG - Intronic
1172701482 20:36856072-36856094 GATGGGGAGAGTCTGGGAAGGGG - Intronic
1172870206 20:38131051-38131073 GCTTTGGGGCCTGGGGGAAGCGG - Intronic
1173021816 20:39273676-39273698 GCTGGGGAACCTCTGGGGAGTGG + Intergenic
1173150289 20:40561475-40561497 ACTGGGGAGTTTCTGGGAAGTGG + Intergenic
1173647558 20:44642891-44642913 GCAGGAGCGCCTCTGGGAAGGGG + Intronic
1173849176 20:46207168-46207190 TCTGAGGAGCCCCAGGGAAGGGG + Intronic
1173855987 20:46251177-46251199 GCTGGGGCGCCTGTGGGCAGCGG - Exonic
1174881951 20:54289496-54289518 TCTGTGGGGCCTTGGGGAAGGGG + Intergenic
1175286692 20:57841343-57841365 GCTGGGGCCCCTCGGGCAGGCGG - Intergenic
1175423529 20:58850742-58850764 GTTGCCGAGCCTCGGGGGAGAGG - Intronic
1175852218 20:62099664-62099686 GCTGGTGAGCATCGGGGCTGGGG - Intergenic
1175988560 20:62776461-62776483 CCTGGGCAGCCACGGGGAACAGG + Intergenic
1178096172 21:29218057-29218079 ACTGGGGAGACTGGAGGAAGTGG - Intronic
1178705704 21:34871107-34871129 GCTCAGGAGCCCCGAGGAAGTGG - Intronic
1178826941 21:36025054-36025076 GCTGGGGAGCCTCTGCGCCGTGG - Intergenic
1179206490 21:39285312-39285334 GCTGGGGAGTATGGGGGAAGGGG + Intronic
1179483351 21:41692597-41692619 GCTGGGAAGGCTCGTGGAAGTGG + Intergenic
1179650764 21:42807045-42807067 GCTGGGCAGGCTCGTGGGAGCGG + Intergenic
1179801363 21:43812947-43812969 GGGGGGGAGCCTCGGGGAAGGGG - Intergenic
1180090342 21:45531004-45531026 CCTGGGGGGCCACGGGGCAGGGG + Intronic
1180790640 22:18573833-18573855 GCTTGGGACCCTCGGGAAGGTGG - Intergenic
1181036994 22:20174509-20174531 GCTGGGGGACCTCGGGCAGGTGG + Intergenic
1181231097 22:21421481-21421503 GCTTGGGACCCTCGGGAAGGTGG + Intronic
1181247551 22:21513387-21513409 GCTTGGGACCCTCGGGAAGGTGG - Intergenic
1181310116 22:21939986-21940008 GCTGGGGACCCTGGGGGGTGGGG + Intronic
1181730810 22:24845008-24845030 TGTGGGCTGCCTCGGGGAAGTGG + Intronic
1183038364 22:35157582-35157604 GCTGGGAGGCCTCAGGGAGGGGG - Intergenic
1183060567 22:35334156-35334178 GCTGTGGGGCCTTGGGCAAGCGG - Intronic
1183251381 22:36732814-36732836 CCTGGAGGGCCTCAGGGAAGAGG - Intergenic
1183453095 22:37906970-37906992 AGTGGGAAGCCTCGGGGGAGAGG - Intronic
1184112236 22:42402146-42402168 CCTAGGAAGCCCCGGGGAAGGGG + Intronic
1184693217 22:46126737-46126759 GTGGGGGAACCTCGGGGGAGGGG - Intergenic
1185279571 22:49964309-49964331 CCTGGGGTGCCTCTGGGAGGTGG + Intergenic
949946024 3:9190849-9190871 GCTGGGGACCCTTAGGGGAGGGG + Intronic
950199676 3:11034250-11034272 GCTGGGGAACTTGGAGGAAGGGG + Intronic
950468030 3:13166980-13167002 GCTGGGCAGCCCCGGGGTGGAGG + Intergenic
950640438 3:14345044-14345066 GGTGGGGAGCCCAGAGGAAGAGG + Intergenic
952884379 3:38003512-38003534 GCTGGGGAGAGTGGGGGCAGTGG + Intronic
952932072 3:38368254-38368276 GATGGTGAGCCTCGGGGTATGGG + Exonic
953980992 3:47412924-47412946 GCTGGGGAGCCTCAGGTAGTGGG - Exonic
954159761 3:48712603-48712625 GCTTGGGAGCCTGAGGCAAGAGG + Intronic
954575830 3:51675680-51675702 GCTGGGGAGGCTCAGAGAAGGGG + Intronic
954745575 3:52785756-52785778 GCTGGGCATCCTTGGGCAAGGGG + Intronic
954912488 3:54121719-54121741 GCTGGGGAGCCCCGGGGCCTGGG + Intergenic
955818664 3:62874331-62874353 GCTGGGGGGGCTCGAGCAAGCGG + Intronic
956039395 3:65130385-65130407 GCTTGGCAGCCTCAGAGAAGAGG - Intergenic
957572187 3:81961282-81961304 GCTGGGGGGACTGGGGGAAAAGG - Intergenic
960416898 3:117396367-117396389 ACTGAGGAGCCTTGGAGAAGAGG - Intergenic
960681195 3:120249391-120249413 GCTGTGTAGCCTGGGGTAAGGGG - Intronic
963606019 3:147412096-147412118 GATGCGGAGCGTCGGGGAGGGGG + Intronic
965000483 3:162946761-162946783 CCTGGGGAGTCTTGGAGAAGGGG + Intergenic
966100869 3:176267738-176267760 GCAGTGGAGCCTCAGGGATGAGG + Intergenic
966774661 3:183533380-183533402 ACTGGGGAGCCTGAGGGAAGAGG - Intronic
966900402 3:184479877-184479899 GCTGAGGAGCCCCGAGGAAGAGG - Intronic
967667871 3:192196011-192196033 GCTGGGGTGGTTGGGGGAAGGGG - Intronic
968008935 3:195260448-195260470 CCTGGGCAGCCTCGGGCACGGGG + Intronic
968448949 4:666221-666243 GCTGGGGAGAGGCGGGGAGGGGG - Intronic
968516318 4:1017118-1017140 GCTGAGTGGCCTGGGGGAAGGGG - Intronic
968582789 4:1402694-1402716 GCGCGGGAGCCTGGGAGAAGGGG + Intergenic
968612583 4:1563923-1563945 GCTGGGGAGAGTGGGGGCAGAGG - Intergenic
968830519 4:2931141-2931163 CCTGGTGAGCCTGTGGGAAGAGG + Exonic
969315895 4:6381183-6381205 GCTGTGGGGCCTCGGGGAGCGGG - Intronic
969487550 4:7480753-7480775 GCTGGGGAGCCTGGGGCGGGTGG - Intronic
969636128 4:8370409-8370431 GCTGAGGAGCCACAGGGAGGCGG + Intronic
973685421 4:53365332-53365354 GCTGGGAAGCCTGGGTGATGTGG - Exonic
974543839 4:63275138-63275160 CTTGGGGAGCCTTGGGGAATGGG - Intergenic
976653915 4:87466776-87466798 ACTGGGGAGCCTGTGGGAGGTGG + Intergenic
978261672 4:106767852-106767874 GCTGTGCAGCCTGGGGTAAGGGG - Intergenic
979230735 4:118346619-118346641 GCTGGGCAGCCTGGGGGTTGGGG - Intronic
981322911 4:143413790-143413812 GGTGGGGATGCTCTGGGAAGTGG - Intronic
981614289 4:146630707-146630729 GCTGGGAAGCCACCAGGAAGTGG - Intergenic
982121728 4:152149873-152149895 GCTTTGGAGCCTGGGGGAGGAGG - Intergenic
984196446 4:176663306-176663328 GCTGGGGAGCATAGGGTGAGGGG - Intergenic
984699075 4:182807092-182807114 GCTGGGGAGCTGCGGGGAAGCGG - Intergenic
985376010 4:189339199-189339221 GCTGGGGAGCCCCAGGAAAGTGG - Intergenic
989348986 5:40462962-40462984 GCTGGGAAGGCTCGTGGAAGGGG + Intergenic
990008643 5:50969658-50969680 GCTGGAGTGCCGCGGGGAGGGGG - Intergenic
990398104 5:55405270-55405292 GCTGGGGAGACTGGGGAAACTGG - Intronic
992158638 5:73979662-73979684 GGTGGGGAGACATGGGGAAGGGG - Intergenic
992428683 5:76685927-76685949 GCTGGGCAGCAGCGGGGAATGGG - Intronic
992432048 5:76718942-76718964 GCTGGGGACCCTCCTGCAAGGGG - Intronic
994934519 5:106237254-106237276 GGTGGAGAGCCAAGGGGAAGGGG + Intergenic
995766696 5:115626400-115626422 GCTGGGGAGCATCTAGGGAGTGG + Intronic
996511955 5:124326388-124326410 GCTGGGGAGGGTTGGGGAAAGGG + Intergenic
997595119 5:135102200-135102222 CCTGGGGAGCCTGGGGAAGGAGG - Intronic
998131110 5:139651396-139651418 GCTGGGGTGGGTGGGGGAAGGGG + Intronic
998134560 5:139668026-139668048 GCTGGGAGGCCTCGGGCAGGTGG - Intronic
998158521 5:139799770-139799792 GCTGGGGGGTATCGGAGAAGGGG + Intronic
998377071 5:141698283-141698305 GCTGTGGAGACTGGGGGAAGGGG - Intergenic
1000052701 5:157575923-157575945 GCTGGCGAGACTCGGGGGAGCGG + Intergenic
1000296393 5:159916605-159916627 GCGGGGGAGCGGCGGGGAGGAGG - Intergenic
1000335022 5:160235688-160235710 GCTGGAGAGCTTCAGGGAGGAGG - Intronic
1001070354 5:168579761-168579783 GCTGAGGGGCCTCGGAGGAGGGG - Intergenic
1002518792 5:179778757-179778779 CCTGGAGAGACTCGGGGTAGTGG - Intronic
1003155067 6:3586408-3586430 CATGGGGAGCCTTGGAGAAGTGG - Intergenic
1005016755 6:21381754-21381776 GGTGGTGACCCTGGGGGAAGTGG + Intergenic
1005648438 6:27864621-27864643 ACTGGGGAGGCTCAGGGAGGAGG + Intronic
1006021608 6:31120994-31121016 GAGGGGGAGCCTGGGGGATGGGG - Intronic
1006026126 6:31148317-31148339 GCTGAGGATCCTCAGGCAAGAGG - Intronic
1006145502 6:31956838-31956860 GCTGGAGAGACAAGGGGAAGAGG + Exonic
1006193340 6:32222686-32222708 GCTGGGGAGCCCTAGGGGAGCGG + Exonic
1006479483 6:34280248-34280270 GCTGTGAAGACACGGGGAAGAGG + Exonic
1006590345 6:35150582-35150604 GCTGGGGAATCTCGGGCAGGAGG - Intergenic
1007919478 6:45593485-45593507 GGAGGGGAGCCTGAGGGAAGAGG - Intronic
1010188305 6:73167415-73167437 GCTTTGGAGCCTCAGGGAACTGG + Intronic
1011243259 6:85295346-85295368 GCTGTGAAGACTCAGGGAAGAGG + Intergenic
1011734303 6:90296512-90296534 GCCGGGAAGACGCGGGGAAGAGG - Exonic
1012892112 6:104908299-104908321 GCTGGGGTGCTTAAGGGAAGAGG + Intergenic
1013602809 6:111720868-111720890 GATGAGGAGCCTGGGAGAAGAGG - Intronic
1017806989 6:157954649-157954671 GCTCGGGAGGCTCGGAGCAGGGG + Intergenic
1017810787 6:157981988-157982010 GCTGGGGCGCCTGGGGGCCGAGG + Exonic
1019481752 7:1270193-1270215 CCAGGGGAGCCCTGGGGAAGGGG - Intergenic
1019552224 7:1608688-1608710 ACTGGGGAGCCTTGGAGAGGGGG + Intergenic
1019576791 7:1741449-1741471 GCTGGGGAGCCTGTGTGATGAGG - Intronic
1020265929 7:6560039-6560061 GCTGGGGAGGCTCATGGAACAGG - Intergenic
1020423050 7:8031407-8031429 GGTGGGGAGCCATGGGGAGGTGG + Intronic
1021101389 7:16588386-16588408 GCTGGGGAGGCTGGGGCAGGAGG + Intergenic
1023845434 7:44117524-44117546 AGTGGGGAGCCTGGGGGGAGTGG - Intronic
1024154105 7:46602994-46603016 GCTGTGTAACCTTGGGGAAGGGG - Intergenic
1025901904 7:65751360-65751382 GCTGCGGAGCCCCGAGGCAGCGG - Intergenic
1025959062 7:66205006-66205028 GCAGGGGAGCCGCGGGCAGGTGG - Intergenic
1025988259 7:66474589-66474611 GCCGTGGAGCCCCGGGGAGGCGG - Intergenic
1026741997 7:72984642-72984664 CTTAGGGAGCCTCTGGGAAGAGG + Intergenic
1026801843 7:73405070-73405092 CTTAGGGAGCCTCTGGGAAGAGG + Intergenic
1026911708 7:74094964-74094986 GTCTGGGAGCCTAGGGGAAGGGG - Intronic
1027101738 7:75380435-75380457 CTTAGGGAGCCTCTGGGAAGAGG - Intergenic
1027211250 7:76150489-76150511 GCCGTGGAGCCCCGGGGAGGCGG - Intergenic
1029169027 7:98617872-98617894 CCTGGAGAGCCTCGAGGTAGCGG + Exonic
1029200263 7:98834710-98834732 CCTGGGGAGGCGAGGGGAAGTGG + Intergenic
1029232045 7:99078524-99078546 GCTGTGCAGCCTGGGGGATGGGG - Intronic
1029482948 7:100823960-100823982 GCTGGGGAGCCGCCAGGGAGAGG + Intronic
1029495978 7:100895683-100895705 GCGGGGCAGGCCCGGGGAAGCGG + Intronic
1029603372 7:101583184-101583206 GCTGGGGTCCCTCAGGGATGAGG + Intergenic
1029635432 7:101780491-101780513 GCTGTGGAGCCTGTGGGATGGGG + Intergenic
1029690413 7:102177627-102177649 GCTGCTGAGCGTTGGGGAAGAGG - Intronic
1030061060 7:105621734-105621756 GCTGGGAGGCCTGGAGGAAGGGG - Intronic
1030286834 7:107835708-107835730 GATGTGGAGGCTAGGGGAAGTGG - Intergenic
1031375387 7:121018425-121018447 GTTGAGCAGCCTGGGGGAAGAGG + Intronic
1031923190 7:127615894-127615916 GGTGAGGAGCCTGGGGGAAGTGG - Intronic
1032084402 7:128876548-128876570 GCTGAGGAACCACGGAGAAGGGG - Intronic
1032401515 7:131627573-131627595 GCTGGGAAGCCTGGGGGTGGAGG + Intergenic
1032799868 7:135309321-135309343 GCAGGGGAGCTTCAGAGAAGAGG + Intergenic
1033165525 7:139035828-139035850 GCAGGAGGGCCTCGGGGACGCGG - Exonic
1033755938 7:144398483-144398505 GCTGTGGAGCCTGGGAGAACTGG + Exonic
1034982005 7:155485068-155485090 GCTGGGGAGACTGGGGTAAAGGG + Intronic
1035167430 7:157000033-157000055 GCAGGGGACCCTCGGGGAGGAGG - Intronic
1035253598 7:157612841-157612863 GCTGGGGTGAAGCGGGGAAGCGG + Intronic
1035370201 7:158375050-158375072 GCTGCTGAGCCTCGGGGATGTGG - Intronic
1035381757 7:158445195-158445217 GCTGGCCAGCCTCGGGGACAGGG - Intronic
1035451774 7:158981300-158981322 GGTTGGGAGGCTCAGGGAAGAGG + Intergenic
1037754690 8:21703274-21703296 GCAGGGGAGCCTAGGGGAGGAGG + Intronic
1037963314 8:23115812-23115834 GCTGGGGAGGGTCTGGGAAGGGG - Intronic
1037967702 8:23146745-23146767 GCTGGGGAGGGTATGGGAAGGGG + Intronic
1038437684 8:27547704-27547726 GCTGGGAAGGGTTGGGGAAGAGG - Intergenic
1038616949 8:29104143-29104165 GCTGGGGAGCGCCGAGGCAGTGG - Intronic
1038871937 8:31504366-31504388 GCTGTGAAGCCTGGGGGTAGGGG + Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1040593835 8:48819318-48819340 GCAGGGGTGCATCTGGGAAGAGG + Intergenic
1045377410 8:101588479-101588501 GGTGGGGAGCCACTGGGAAGTGG - Intronic
1048223879 8:132566595-132566617 GGTGAGGAGCCTGGGAGAAGAGG - Intergenic
1048323709 8:133422536-133422558 GAGGGGGAGCCTTGAGGAAGAGG - Intergenic
1048350510 8:133612039-133612061 GCTAGGGAGGCTCTGGGAATGGG + Intergenic
1049178821 8:141209956-141209978 GGTGGGAAGCCTCAGGCAAGGGG + Intronic
1049580501 8:143408570-143408592 GGTGGGGAGCCTGGGGGTTGGGG - Intergenic
1049601899 8:143511869-143511891 CCTGCGGAGGCTTGGGGAAGGGG - Intronic
1049765074 8:144351446-144351468 GCTGGGGAGCTTTGGGGGAAGGG - Intergenic
1051822171 9:21181136-21181158 GATGGGGATTCTCAGGGAAGAGG - Intergenic
1051825225 9:21211734-21211756 GATGGGGATTCTCAGGGAAGAGG - Intronic
1052383518 9:27797896-27797918 TCTGGGAAGCCTTAGGGAAGGGG + Intergenic
1052650005 9:31290620-31290642 GATGAGGAGCCTTGGGGAATAGG - Intergenic
1052817448 9:33112328-33112350 CCTGGGGAGGGTTGGGGAAGTGG + Exonic
1053056736 9:34997426-34997448 GCTGGGCTGCCTGGGGGGAGTGG + Exonic
1053230167 9:36401137-36401159 GGTGCGGAGCCTGGGGGAAAAGG - Intronic
1054461151 9:65465441-65465463 CCTGGGGAGCCTAGGGGACCTGG - Intergenic
1055207652 9:73751752-73751774 GATGGAGAGCCTTGGGGAATGGG + Intergenic
1055373439 9:75624583-75624605 GCTGGGGATACCCAGGGAAGAGG + Intergenic
1056207515 9:84334689-84334711 GCTAGGGAGGGGCGGGGAAGGGG - Intronic
1056985576 9:91361592-91361614 GCTGGGCAGGCGCGGGGCAGCGG - Intronic
1057685573 9:97231069-97231091 GCTGGGGAGGCTGTGGCAAGAGG + Intergenic
1059856419 9:118403191-118403213 GCTGGAGAGCTTGGAGGAAGGGG - Intergenic
1060068627 9:120527005-120527027 GCTGGGGAGGCAGAGGGAAGGGG - Intronic
1060106719 9:120877236-120877258 GCGGGGGCGCCGCGGGGAGGAGG + Exonic
1060555422 9:124505120-124505142 GCTGGGGGGCCTGGAGGATGAGG - Intronic
1060918735 9:127406070-127406092 GCTGGGAAGCCCCGGGACAGGGG - Intronic
1060931284 9:127491084-127491106 GCTGGGGAGGCTCTGGAATGAGG - Intronic
1060983813 9:127808581-127808603 GCTGGAGGCCCTCGAGGAAGGGG + Exonic
1061348169 9:130043140-130043162 GCTGTGGAGCGGCGGGGAGGAGG - Exonic
1061382603 9:130267230-130267252 GCTGGGGAGGCTGGGTGCAGTGG - Intergenic
1061519767 9:131111290-131111312 GCTGGGGTGTCTTGGGGGAGGGG + Intronic
1061963513 9:134000029-134000051 GCTGGGGAGCCTCCTGAATGTGG + Intergenic
1062085576 9:134646323-134646345 GCTGGGGAGCTTCCTGGAGGAGG + Intronic
1062196659 9:135278046-135278068 GCTGGGGACCCAAGGGGAACAGG + Intergenic
1062403433 9:136382420-136382442 GCTTTGGAGCCTGGGTGAAGAGG - Intronic
1062440389 9:136566999-136567021 GCTGGCGAGCCACGGGAAGGCGG + Intergenic
1062585456 9:137247487-137247509 GCTGGGGAGCCCTGGGACAGGGG - Intronic
1062600209 9:137316022-137316044 GCTCTGGAGCCCCGGGGAGGGGG - Intronic
1186888730 X:13939166-13939188 GCTGGGGAGCTTCTGGAAACCGG + Intergenic
1187193710 X:17060665-17060687 GCTGGGGAGGCTCTGAGAGGGGG + Intronic
1187844861 X:23524743-23524765 GCTGTGTAGCCTCGGGTTAGGGG - Intergenic
1188094799 X:26008143-26008165 GCTAGGGATCCTTGGGGAAATGG + Intergenic
1189331916 X:40149361-40149383 GCTGGGGACCCCTGGGGAGGCGG + Intronic
1189400948 X:40667962-40667984 GCTGGGGTGTCTGTGGGAAGAGG + Intronic
1190911592 X:54776492-54776514 GCTGTGGAGCCTGGGGTTAGAGG - Intronic
1191966689 X:66766735-66766757 GATAGAGAACCTCGGGGAAGGGG - Intergenic
1194375061 X:93122280-93122302 GCGGGGGAGCAGTGGGGAAGTGG - Intergenic
1195154976 X:102113742-102113764 GCTGTGCAGCCTCGGGTCAGGGG + Intergenic
1195398475 X:104436559-104436581 CCTGGGCAGGCTTGGGGAAGGGG - Intergenic
1195940168 X:110161343-110161365 GCAGGGAAGCCTCATGGAAGAGG - Intronic
1196275325 X:113760114-113760136 ACTTGGGAGGCTCAGGGAAGAGG - Intergenic
1197708495 X:129650398-129650420 GCTCAGAAGCCTGGGGGAAGAGG - Intronic
1198019205 X:132641944-132641966 GCTGAGGGGCCTGGGGGCAGGGG + Intronic
1198242126 X:134796943-134796965 GCTGAGGAGCCTCCGGGACCGGG - Intronic
1198424121 X:136497545-136497567 GCTGGGGCGCAGCGGGGAGGCGG + Intronic
1198733328 X:139758437-139758459 GCTGTGCAGCCTCGGGGGAGGGG - Intronic
1199086620 X:143635581-143635603 ACTGGAGAGCCTGGGGGAGGGGG + Intronic
1199944727 X:152656212-152656234 GCTGGGGAGGGGCTGGGAAGGGG - Exonic
1200075592 X:153549116-153549138 GCTGGGAGGCAGCGGGGAAGCGG + Intronic
1200143388 X:153913179-153913201 GCAGGGGAGAGGCGGGGAAGGGG + Intronic
1200163109 X:154019273-154019295 GCTGCTGGGCCTCGGGGCAGTGG + Exonic
1200763840 Y:7063801-7063823 GCAGGAGAGGCACGGGGAAGTGG - Intronic
1200795267 Y:7335255-7335277 GCTGGGGAGGTGCAGGGAAGGGG + Intergenic