ID: 1164148598

View in Genome Browser
Species Human (GRCh38)
Location 19:22529186-22529208
Sequence GCCTCCGGAGTGACCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 3, 2: 12, 3: 30, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164148598_1164148604 8 Left 1164148598 19:22529186-22529208 CCTGCCCTGGTCACTCCGGAGGC 0: 1
1: 3
2: 12
3: 30
4: 244
Right 1164148604 19:22529217-22529239 CTACACACGGCTGAAGCTTGAGG 0: 3
1: 8
2: 26
3: 51
4: 150
1164148598_1164148602 -5 Left 1164148598 19:22529186-22529208 CCTGCCCTGGTCACTCCGGAGGC 0: 1
1: 3
2: 12
3: 30
4: 244
Right 1164148602 19:22529204-22529226 GAGGCTGACCAGTCTACACACGG 0: 3
1: 6
2: 19
3: 43
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164148598 Original CRISPR GCCTCCGGAGTGACCAGGGC AGG (reversed) Intronic
900113850 1:1020450-1020472 GGCTGCGGAGCGACCGGGGCTGG - Intronic
901785115 1:11619463-11619485 GACCCTGGAGTGATCAGGGCAGG - Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
905046519 1:35007682-35007704 GCCTCCCGAGTAACCAGGAGAGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905286768 1:36885697-36885719 GCCCCCACAGGGACCAGGGCAGG + Intronic
905536806 1:38728770-38728792 GCCTCATGAGTGGGCAGGGCAGG - Intergenic
907516598 1:54997058-54997080 GCCTGCGGAGTGGCAGGGGCTGG - Intergenic
908114293 1:60925681-60925703 ACCTACAGAGTGACCTGGGCAGG + Intronic
908174347 1:61539615-61539637 GCCTCTGGAGTCACCCAGGCTGG + Intergenic
908973420 1:69865839-69865861 ACCTCAGGAGTGACCTGGCCAGG + Intronic
912550974 1:110485058-110485080 ACCTCCTGAGCCACCAGGGCAGG - Intergenic
912715216 1:111978673-111978695 CCCTCCTGGGGGACCAGGGCTGG + Intronic
917981426 1:180271998-180272020 GCTTCCGAGGTGAGCAGGGCTGG + Exonic
922700180 1:227754700-227754722 GCCTCCTGAAGGAGCAGGGCAGG - Intronic
922788402 1:228295227-228295249 ACCTCAGGAGTGAATAGGGCAGG + Intronic
924457554 1:244230778-244230800 GCCTCCAGAGAGTCCACGGCGGG + Intergenic
924741913 1:246799146-246799168 GCCGCAGGAGTCACCAGGGAGGG - Intergenic
1063141021 10:3256758-3256780 GCCTGTGGAGAGACCAGGCCAGG + Intergenic
1064594327 10:16928180-16928202 GACTCCAGTGTAACCAGGGCAGG - Exonic
1067011075 10:42714453-42714475 GACTCCAGTGTAACCAGGGCAGG - Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1067161043 10:43825564-43825586 GACTCCGCAGTGAGCAGGGAGGG + Intergenic
1067312522 10:45127418-45127440 GACTCCAGTGTAACCAGGGCAGG + Intergenic
1068828014 10:61461518-61461540 GTCTCTGGAATGACCAGGGAAGG + Intergenic
1069559026 10:69416684-69416706 ACTTCCTGAGTGACCTGGGCTGG - Exonic
1070670643 10:78375085-78375107 GGTTCCTGAGTCACCAGGGCTGG - Intergenic
1072105670 10:92271060-92271082 GCCTCCTGAGTGACTGGGGCTGG - Intronic
1072724821 10:97806157-97806179 GGCCCAGGAGTGCCCAGGGCTGG - Intergenic
1072805843 10:98423716-98423738 GCCCCCTGGGTGGCCAGGGCAGG - Intronic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1073255273 10:102146920-102146942 ACCTCTGGAATGACTAGGGCAGG - Exonic
1074498142 10:113997714-113997736 GCCTCTGAAGTCAGCAGGGCAGG - Intergenic
1074883729 10:117678662-117678684 ACCTCCTGAGTGTCCATGGCTGG + Intergenic
1076570855 10:131432042-131432064 GCCACGGCCGTGACCAGGGCTGG - Intergenic
1077392151 11:2305063-2305085 GCCTCCTGGGTCCCCAGGGCTGG + Intronic
1082782813 11:57300464-57300486 GCCTCCGAAGCCTCCAGGGCAGG + Intronic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084430241 11:69106856-69106878 ACCTGCTGAGTGACCAGGGCAGG + Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085046064 11:73354377-73354399 GCCTCTGGACAGAACAGGGCAGG - Intronic
1085249989 11:75136734-75136756 TCCTCTGGATTGACCAGGCCTGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085728584 11:78976720-78976742 TGCTCCTGAGTGACCAGGTCTGG + Intronic
1088975576 11:114813358-114813380 GCCTGAGGAGGGACCAGGCCAGG + Intergenic
1091701712 12:2667691-2667713 GCCTCCGGACGGGCCTGGGCAGG + Intronic
1092245721 12:6863278-6863300 TCATCCGGAGTGACCAGGGGTGG - Exonic
1102199279 12:111046272-111046294 GCTTGCGGAGAGACCAGTGCAGG + Intronic
1103414865 12:120737213-120737235 GTCTCCAGAGAGATCAGGGCTGG - Intronic
1104284698 12:127414357-127414379 ACCTCCGGCTTAACCAGGGCTGG + Intergenic
1105979211 13:25501420-25501442 GGCTCTGGAATGATCAGGGCAGG + Intronic
1106140251 13:27005817-27005839 GGCTCTGGGGTGATCAGGGCAGG + Intergenic
1107425099 13:40284594-40284616 GCCTCAGGGGTGACTAGGGAAGG + Intergenic
1110302546 13:73946058-73946080 GACTCCGGAGAGTCGAGGGCTGG - Intronic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1113574265 13:111382907-111382929 GCCTACTGGGTTACCAGGGCAGG + Intergenic
1113798997 13:113076883-113076905 CCGTCCGTAGTGGCCAGGGCTGG + Intronic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1115642046 14:35341254-35341276 GCCTCCCCAGTGCACAGGGCTGG + Intergenic
1118313022 14:64706766-64706788 GCCTGCGGGATGACCAGGGCTGG + Intronic
1118913798 14:70083865-70083887 GCCTCCGGAATGTCCAGGTATGG - Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1119264224 14:73254652-73254674 CCCTCCTCAGTGACCAGGCCTGG + Exonic
1122341017 14:101028557-101028579 GCCTCCGGGGTATCCAGGGTAGG + Intergenic
1122819461 14:104334176-104334198 GCAGCCGGAGGGCCCAGGGCAGG + Intergenic
1123019751 14:105392144-105392166 TGCTCCGGAGAGACCCGGGCGGG - Intronic
1123027389 14:105433150-105433172 GGCTCAGGAGAGACCAGGGGTGG + Intronic
1123028368 14:105439188-105439210 GCTGCCTGAGTGACCAGGGAGGG - Intronic
1123028387 14:105439267-105439289 GCTGCCTGAGTGACCAGGGAGGG - Intronic
1123066111 14:105620246-105620268 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123070255 14:105639299-105639321 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123074845 14:105662958-105662980 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123089492 14:105736083-105736105 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123095280 14:105764243-105764265 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1124121214 15:26890784-26890806 TCCTCCTGAGTGCCCAGTGCCGG - Intronic
1127639911 15:60906679-60906701 GCCCCTGGATTGGCCAGGGCTGG - Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129243905 15:74268449-74268471 GGCTCTGGAGGTACCAGGGCTGG + Exonic
1130938857 15:88491380-88491402 CCCTCCTGAGTGATCCGGGCAGG + Intergenic
1132055721 15:98649175-98649197 GCCTCCCGCGCGGCCAGGGCCGG + Exonic
1132592559 16:732518-732540 GCTTCAGGAGTGACCGGGCCTGG - Intronic
1133018686 16:2956400-2956422 GGCCCGGGAGTGCCCAGGGCTGG - Intergenic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1134290886 16:12902212-12902234 GCCTCCGGAGAGGCCAGCGAGGG + Exonic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1135797217 16:25457122-25457144 GACTCTGGGGTGATCAGGGCAGG + Intergenic
1136271951 16:29153699-29153721 GCCTCCGGAGGGACTATGGCTGG - Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1138352277 16:56352387-56352409 GCCCCTAGAGGGACCAGGGCTGG - Intronic
1138430115 16:56963134-56963156 GCCTCGGGTGTGACCAGGCTGGG + Intronic
1139377603 16:66509923-66509945 GCATCAGCAGTGGCCAGGGCAGG - Exonic
1139877718 16:70159754-70159776 GCCTCTTGAGTGAACAGGGGAGG + Exonic
1141731854 16:85828316-85828338 GCCTCGGGAGTGACCTGCACAGG + Intergenic
1142075581 16:88115753-88115775 GCCTCCGGAGGGAGTATGGCTGG - Intronic
1142168236 16:88605180-88605202 GCCCCCTGAGTGAGCAGGGAGGG + Intronic
1142494931 17:301088-301110 GCCTCAGGGGGGCCCAGGGCTGG + Intronic
1142602581 17:1061414-1061436 GCCCCAGGAGTGTTCAGGGCTGG - Intronic
1143515606 17:7417834-7417856 GCCTTCGGAGTGGCCGGGCCAGG - Exonic
1144219435 17:13086651-13086673 GCCTGCGGAGAGTCCAAGGCAGG - Intergenic
1147259495 17:39200504-39200526 GCCTCCGGAGTGAGGGGGGGCGG + Intronic
1147331272 17:39700698-39700720 GCCTCCGGACTGGCCTGGGCTGG + Intronic
1147864980 17:43546076-43546098 GCCTCCGCAGATTCCAGGGCGGG - Intronic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1150217003 17:63476679-63476701 GCCTCCGGAGTGACAAGGCCGGG - Intergenic
1151338378 17:73454368-73454390 GACTCCGGAGTTGGCAGGGCTGG + Intronic
1152823048 17:82446836-82446858 GGGTCCTGAGTGGCCAGGGCAGG - Intronic
1152836778 17:82538362-82538384 GCCTCCCAAGTGTCCAGGACTGG - Intronic
1152858461 17:82680108-82680130 GCCTCCGGTCTGAGCAGGACGGG - Intronic
1153626101 18:7023624-7023646 GCATCCGGAGTGGTCAGGGGTGG - Intronic
1153761960 18:8340091-8340113 GCCACCACAGTGACCAGGCCAGG + Intronic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1157681215 18:49608540-49608562 GCCTCTGCAGTGTCCAGGCCAGG - Intergenic
1158913303 18:62091222-62091244 GCCTCCCGAGTTAGCTGGGCAGG - Intronic
1158960642 18:62584999-62585021 GCCTCTGGACTGAGGAGGGCTGG + Intronic
1160427773 18:78790184-78790206 ACCTCAGGAGGGAGCAGGGCTGG - Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1160810955 19:1012751-1012773 GCCTCTGCAGTGCACAGGGCAGG - Intronic
1161083134 19:2321378-2321400 GGTTCAGGAGTGACCAAGGCGGG - Intronic
1161231810 19:3178420-3178442 GCTTCGGGGGTGATCAGGGCTGG + Intronic
1161260604 19:3335781-3335803 GCCACCGGTGTGACCAGACCAGG + Intergenic
1161516762 19:4700725-4700747 GCCTCCGGAGGGCGCAGGTCTGG - Intronic
1161558892 19:4959826-4959848 GCCTCCGGAGTAGCCACGCCCGG + Intronic
1162817799 19:13207163-13207185 GACTCTGGAGAGGCCAGGGCTGG - Exonic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1165358592 19:35319400-35319422 GGCTCTGGAGTGGCCAGTGCTGG - Intronic
1166083541 19:40459982-40460004 GCCTACAGACTGACCAGTGCTGG + Intronic
1166526196 19:43511528-43511550 GCCTGGGGTGTGGCCAGGGCTGG + Exonic
1166536925 19:43580420-43580442 GTCTGAGGAGTGACCATGGCAGG + Intronic
1166690895 19:44820778-44820800 GCCTCCGGAGGAGCCAGGGGTGG + Exonic
1166771767 19:45287660-45287682 CCCCCGTGAGTGACCAGGGCTGG + Exonic
1167015649 19:46839371-46839393 GGCTCAGGAGGGACCAGGGAGGG + Intronic
1167302330 19:48685395-48685417 ACCTCAAGACTGACCAGGGCTGG - Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
925177291 2:1794541-1794563 GCCTGTGGGGTGACCAAGGCAGG + Intronic
926109396 2:10172353-10172375 TGCTCCGGAGGGACCAGGGGAGG + Intronic
926192805 2:10741406-10741428 GGCTCCTGAGTCACCAGGGGAGG + Intronic
928201378 2:29249750-29249772 GCCTCCGTGGGGCCCAGGGCGGG - Intronic
932267669 2:70382228-70382250 GCCTTAGGAATGCCCAGGGCAGG - Intergenic
933751028 2:85602298-85602320 TCCTTCTGAGGGACCAGGGCTGG + Exonic
933812516 2:86041799-86041821 TCTTCCGGAGTGAGTAGGGCAGG + Intronic
935414359 2:102799890-102799912 GCCTCGGGAGAGAACAGGACTGG + Intronic
936971558 2:118181330-118181352 GCCTCCTGAGTGCCCTAGGCTGG + Intergenic
937047127 2:118857738-118857760 GCCCGCGGAGAGCCCAGGGCGGG + Intergenic
937793905 2:125994521-125994543 GCATCTGGACTGCCCAGGGCTGG - Intergenic
939871047 2:147526324-147526346 GACTATGGGGTGACCAGGGCAGG - Intergenic
945210255 2:207375326-207375348 GCCTCCCCAGGAACCAGGGCAGG - Intergenic
948461569 2:238132321-238132343 GCCTCCGGAGCACCCTGGGCTGG - Exonic
948729783 2:239955680-239955702 GCCGCAGGACAGACCAGGGCAGG + Intronic
948750356 2:240128699-240128721 GCCACGGGAGTGACCGTGGCTGG + Intronic
949023414 2:241753814-241753836 GCGACAGCAGTGACCAGGGCGGG + Intronic
1170830094 20:19832556-19832578 GGCCCCGGGGTGATCAGGGCTGG - Intergenic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1172617828 20:36300833-36300855 GGCTCTGGAGTGAACAGGCCTGG - Intergenic
1172674021 20:36654634-36654656 TCCTCCTGGGGGACCAGGGCTGG + Intronic
1172802292 20:37584671-37584693 GCTTCCGGAATGACCAGGATGGG + Intergenic
1173705931 20:45110373-45110395 GGCTCCTGGGTGCCCAGGGCAGG - Intronic
1173824847 20:46041541-46041563 GTCTGCGGAGGGACAAGGGCTGG + Intronic
1173906313 20:46632179-46632201 TTCTCAGGAGTGTCCAGGGCTGG + Intronic
1175913384 20:62414939-62414961 ACCTCCAGAGTGGCCAGGCCTGG - Intronic
1176024018 20:62976754-62976776 GCCTCCGGAGGAACCAGTCCTGG - Intergenic
1176380762 21:6111223-6111245 GCCACCGGAGCGCCCAGGCCAGG - Exonic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179742710 21:43427017-43427039 GCCACCGGAGCGCCCAGGCCAGG + Exonic
1179842321 21:44085149-44085171 GTCACCAGAATGACCAGGGCAGG - Intronic
1180962429 22:19767927-19767949 CCCTACGGAGTGACCTGGCCAGG + Intronic
1182621066 22:31618871-31618893 GGCACCAGAGTGAACAGGGCAGG - Exonic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1183616714 22:38950231-38950253 TCGTCCAGGGTGACCAGGGCCGG - Intergenic
1184285194 22:43466694-43466716 GCCCCTGGGGTGATCAGGGCAGG - Intronic
1184943321 22:47784142-47784164 GCGTGGGGAGTGACCAGGGCCGG - Intergenic
1185272969 22:49937080-49937102 GCCTCCGGGGAGAGCAGGGTGGG + Intergenic
949881206 3:8662380-8662402 ACCTCAGGAGGGACCAGGTCAGG - Intronic
950135689 3:10579328-10579350 GCCTCCTGAGTGGCCAAGGTGGG + Intronic
953290241 3:41653205-41653227 GGCTCTGGAGTGATCAGGGCAGG - Intronic
953582270 3:44167729-44167751 GCTTCTGGAGAGAACAGGGCTGG - Intergenic
954692399 3:52402517-52402539 GCCTCAGGAGAGGCCAGGGGAGG + Intronic
955582727 3:60442154-60442176 CCTTTCAGAGTGACCAGGGCTGG - Intronic
956444163 3:69309249-69309271 GCCTCCTGAGTGGCTAGGACTGG + Intronic
957616179 3:82530445-82530467 TTTTCCAGAGTGACCAGGGCTGG + Intergenic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961358637 3:126354244-126354266 CCCTGCTCAGTGACCAGGGCAGG + Intronic
961464734 3:127074420-127074442 TCCTGCCCAGTGACCAGGGCTGG - Intergenic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
961795190 3:129403942-129403964 GCCTCCTTAGAGAACAGGGCTGG - Intronic
962935583 3:140077598-140077620 GCCTCAGCAGTGTACAGGGCAGG - Intronic
963312226 3:143721572-143721594 CCCTCCTGAGTGCCCAGGGGAGG - Intronic
963752862 3:149201242-149201264 GCCTCCAGAGTAACTAGGACAGG + Intronic
965590630 3:170357626-170357648 GTCTCCGCAGTGACGTGGGCGGG + Intergenic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
968701883 4:2061313-2061335 GCCTCCGGTGTCAGCGGGGCTGG + Intronic
968879338 4:3291196-3291218 GCCTCCTGAGGCTCCAGGGCAGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971264931 4:25088865-25088887 GCCTCCTGAGCGAGCAGCGCCGG - Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
977945227 4:102905339-102905361 GCCTCCTGAGTAGCCAGGACTGG + Intronic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
985513011 5:322469-322491 GCCTCCGGGATGGCAAGGGCAGG + Intronic
986307344 5:6525519-6525541 GTCCCCACAGTGACCAGGGCAGG - Intergenic
986411888 5:7489078-7489100 GCCTCAGGAGTGCTCTGGGCAGG - Intronic
992098445 5:73382604-73382626 GCCTCCAGAGGGAACAGGCCTGG + Intergenic
997712189 5:136015206-136015228 GCCTGGGGAGGGAGCAGGGCGGG + Intergenic
1000013156 5:157252764-157252786 GCCTCTGGAGGGTCCTGGGCTGG - Exonic
1001254567 5:170173509-170173531 GCCTACAGAGTGGCCAGCGCTGG + Intergenic
1001755516 5:174165505-174165527 GCCTGCGGTGTGACCTTGGCTGG - Intronic
1002202498 5:177537985-177538007 GTCTCCCGAGTTCCCAGGGCAGG + Exonic
1002431027 5:179203938-179203960 GCCACCGGAGTGCCCATGGATGG + Intronic
1003115459 6:3280977-3280999 GCTGCCGGAGTGGGCAGGGCAGG + Intronic
1003317673 6:5026694-5026716 GCCTATGGAGTCACCAGGGCAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006016225 6:31083286-31083308 GCCTCCGGAGTAGCTGGGGCTGG - Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006339878 6:33440975-33440997 GCTTCAGGAGTGGGCAGGGCAGG + Intronic
1006861052 6:37171532-37171554 GCCTCCGGACTGGGCCGGGCCGG - Intronic
1007730539 6:43942808-43942830 GCTTCCGGAGGGTCCTGGGCAGG + Intergenic
1007759698 6:44126999-44127021 CGCTCCGGAGTGACCAGCGACGG + Exonic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011229205 6:85140929-85140951 GCCTCCTGACTAACCTGGGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1012474784 6:99606898-99606920 GCCCGCGGAGTGACGCGGGCGGG - Exonic
1015811224 6:137163837-137163859 GTCTCGGGAGAGACCAAGGCGGG + Intronic
1018888618 6:167963980-167964002 GGCTCCGGCGTGGCCAGGACTGG - Exonic
1019640203 7:2099264-2099286 GGCGCCGGAGTGCACAGGGCAGG - Intronic
1019748527 7:2714159-2714181 CCCTTCGGAGTGACGAGGGCGGG + Exonic
1020112667 7:5456272-5456294 GCCTCCTGAGAGCCCAGGGCAGG - Intronic
1023871708 7:44266763-44266785 GCCTCCTGAGTGGCCAGCCCTGG + Intronic
1025701457 7:63824031-63824053 GACTCCTGTGTCACCAGGGCTGG - Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1029110114 7:98209741-98209763 AGCTCCAGAGGGACCAGGGCAGG - Intergenic
1032159236 7:129498120-129498142 GCCTCAGGAGGCAGCAGGGCTGG + Intergenic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034163383 7:149008114-149008136 GCCTGCGGGGTGTCCAGGGCTGG + Intronic
1034275624 7:149822598-149822620 GCGTCCCGAGGGGCCAGGGCAGG + Intergenic
1034344730 7:150379306-150379328 GCCCCGGGAATGGCCAGGGCCGG + Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1034489826 7:151387265-151387287 GCTTGCTGGGTGACCAGGGCAGG + Intronic
1035740303 8:1922726-1922748 GCCTCCTGAATGCCCAGGCCTGG - Intronic
1036032976 8:4992767-4992789 GCATCCGGACTGAGCCGGGCGGG + Intronic
1036398393 8:8387020-8387042 GGCGCCGGAGGGAGCAGGGCTGG + Intergenic
1036643891 8:10600532-10600554 GCTTCCGTGGTGACCAGGGGCGG + Intergenic
1037803877 8:22049060-22049082 GCCCCCGGAGGGGCCGGGGCCGG + Intronic
1038349359 8:26762373-26762395 GCTTCCAGAGAGCCCAGGGCAGG - Intronic
1038491468 8:27975036-27975058 GCCACTGGAATGACCAAGGCAGG + Intronic
1039572931 8:38601618-38601640 GGCTTTGGAGTGACGAGGGCTGG + Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1042236109 8:66614165-66614187 CCCTCTGGAGAGACCAGGGAGGG + Intronic
1042873615 8:73420199-73420221 GCCTCCTGGGTGACTCGGGCCGG - Intergenic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049606694 8:143532900-143532922 GCCGCCTGAGTGACCAGGCCAGG + Intronic
1053564725 9:39237086-39237108 GCCTCCGGAGGCAGCATGGCCGG - Intronic
1053830506 9:42074987-42075009 GCCTCCGGAGGCAGCACGGCCGG - Intronic
1054132426 9:61381948-61381970 GCCTCCGGAGGCAGCATGGCCGG + Intergenic
1054600054 9:67112468-67112490 GCCTCCGGAGGCAGCACGGCTGG + Intergenic
1058987771 9:110224692-110224714 GGCTCTGGGGTGACCAGGGTAGG + Intergenic
1059409834 9:114124893-114124915 GCCTCCAGAGTGGGGAGGGCAGG - Intergenic
1059443363 9:114323390-114323412 GCCTCCAGAGTCCCCTGGGCTGG - Intronic
1059444552 9:114330161-114330183 GCCTCCAGAGTCCCCTGGGCTGG - Intronic
1060590188 9:124811496-124811518 GCCTGCCCAGTGACCAGGTCAGG - Exonic
1060747410 9:126146602-126146624 GGCCCCGGAGTGATTAGGGCAGG - Intergenic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061191299 9:129084245-129084267 ACCTCTGGAGTCACCAGGCCGGG + Intronic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061310387 9:129758357-129758379 GCCTCAGGAGTGGGAAGGGCAGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062123142 9:134844995-134845017 CCCTCAGGAGTGGCCAAGGCTGG + Intergenic
1062418051 9:136463374-136463396 GCCTCCCGAAGGAGCAGGGCGGG - Intronic
1187341380 X:18425051-18425073 CCCTCCGGAGGGACCCGTGCCGG - Intergenic
1189717001 X:43877320-43877342 TCCTCAGAAGTCACCAGGGCAGG - Intronic
1191755514 X:64588340-64588362 GCCTTCGGAGAGACCAGTCCTGG - Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic