ID: 1164149179

View in Genome Browser
Species Human (GRCh38)
Location 19:22533551-22533573
Sequence GGTCCCTTTTTCCACATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164149173_1164149179 24 Left 1164149173 19:22533504-22533526 CCTTCTTTTTCTCCATATTTACC No data
Right 1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG No data
1164149177_1164149179 1 Left 1164149177 19:22533527-22533549 CCTCACTTCAACTATAATTTCAC No data
Right 1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG No data
1164149174_1164149179 12 Left 1164149174 19:22533516-22533538 CCATATTTACCCCTCACTTCAAC No data
Right 1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG No data
1164149172_1164149179 25 Left 1164149172 19:22533503-22533525 CCCTTCTTTTTCTCCATATTTAC No data
Right 1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG No data
1164149175_1164149179 3 Left 1164149175 19:22533525-22533547 CCCCTCACTTCAACTATAATTTC No data
Right 1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG No data
1164149176_1164149179 2 Left 1164149176 19:22533526-22533548 CCCTCACTTCAACTATAATTTCA No data
Right 1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164149179 Original CRISPR GGTCCCTTTTTCCACATTCA AGG Intergenic
No off target data available for this crispr