ID: 1164149966

View in Genome Browser
Species Human (GRCh38)
Location 19:22542251-22542273
Sequence GGACCATCCTGGGCAAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164149966_1164149978 28 Left 1164149966 19:22542251-22542273 CCCCATTTTGCCCAGGATGGTCC No data
Right 1164149978 19:22542302-22542324 CCTCCACCTCCCAAAGTGCTAGG 0: 1052
1: 9826
2: 232355
3: 267398
4: 176939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164149966 Original CRISPR GGACCATCCTGGGCAAAATG GGG (reversed) Intergenic
No off target data available for this crispr