ID: 1164151690

View in Genome Browser
Species Human (GRCh38)
Location 19:22559118-22559140
Sequence GATTCCATAGTGTCTTGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164151687_1164151690 12 Left 1164151687 19:22559083-22559105 CCTCTTTAGATCATTCAGCATGG No data
Right 1164151690 19:22559118-22559140 GATTCCATAGTGTCTTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164151690 Original CRISPR GATTCCATAGTGTCTTGCAA TGG Intergenic
No off target data available for this crispr