ID: 1164155755

View in Genome Browser
Species Human (GRCh38)
Location 19:22596053-22596075
Sequence CCGCCCGCTCCCGGAGTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164155735_1164155755 17 Left 1164155735 19:22596013-22596035 CCCCGCCCCTTTCCTCCCACTGG No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155734_1164155755 24 Left 1164155734 19:22596006-22596028 CCGGCGGCCCCGCCCCTTTCCTC No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155737_1164155755 16 Left 1164155737 19:22596014-22596036 CCCGCCCCTTTCCTCCCACTGGA No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155745_1164155755 1 Left 1164155745 19:22596029-22596051 CCACTGGAGCCTGCGGCCCCGCC No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155738_1164155755 15 Left 1164155738 19:22596015-22596037 CCGCCCCTTTCCTCCCACTGGAG No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155739_1164155755 12 Left 1164155739 19:22596018-22596040 CCCCTTTCCTCCCACTGGAGCCT No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155740_1164155755 11 Left 1164155740 19:22596019-22596041 CCCTTTCCTCCCACTGGAGCCTG No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155743_1164155755 5 Left 1164155743 19:22596025-22596047 CCTCCCACTGGAGCCTGCGGCCC No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155746_1164155755 -8 Left 1164155746 19:22596038-22596060 CCTGCGGCCCCGCCCCCGCCCGC No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155744_1164155755 2 Left 1164155744 19:22596028-22596050 CCCACTGGAGCCTGCGGCCCCGC No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data
1164155741_1164155755 10 Left 1164155741 19:22596020-22596042 CCTTTCCTCCCACTGGAGCCTGC No data
Right 1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164155755 Original CRISPR CCGCCCGCTCCCGGAGTCAG CGG Intergenic
No off target data available for this crispr