ID: 1164158726

View in Genome Browser
Species Human (GRCh38)
Location 19:22612481-22612503
Sequence CAGGCTGGTCAGAGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164158726_1164158738 12 Left 1164158726 19:22612481-22612503 CCTGCAGCCCTCTGACCAGCCTG No data
Right 1164158738 19:22612516-22612538 GAGGGCCATAGCAGACTCTGGGG No data
1164158726_1164158733 -6 Left 1164158726 19:22612481-22612503 CCTGCAGCCCTCTGACCAGCCTG No data
Right 1164158733 19:22612498-22612520 AGCCTGGTTCCATCATTGGAGGG No data
1164158726_1164158736 10 Left 1164158726 19:22612481-22612503 CCTGCAGCCCTCTGACCAGCCTG No data
Right 1164158736 19:22612514-22612536 TGGAGGGCCATAGCAGACTCTGG No data
1164158726_1164158737 11 Left 1164158726 19:22612481-22612503 CCTGCAGCCCTCTGACCAGCCTG No data
Right 1164158737 19:22612515-22612537 GGAGGGCCATAGCAGACTCTGGG No data
1164158726_1164158732 -7 Left 1164158726 19:22612481-22612503 CCTGCAGCCCTCTGACCAGCCTG No data
Right 1164158732 19:22612497-22612519 CAGCCTGGTTCCATCATTGGAGG No data
1164158726_1164158730 -10 Left 1164158726 19:22612481-22612503 CCTGCAGCCCTCTGACCAGCCTG No data
Right 1164158730 19:22612494-22612516 GACCAGCCTGGTTCCATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164158726 Original CRISPR CAGGCTGGTCAGAGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr