ID: 1164159123

View in Genome Browser
Species Human (GRCh38)
Location 19:22615263-22615285
Sequence AGGAACAGAAGGAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164159120_1164159123 -3 Left 1164159120 19:22615243-22615265 CCTTGGGTGGTGAGACAGGCAGG 0: 2
1: 0
2: 3
3: 29
4: 332
Right 1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG No data
1164159119_1164159123 -2 Left 1164159119 19:22615242-22615264 CCCTTGGGTGGTGAGACAGGCAG No data
Right 1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164159123 Original CRISPR AGGAACAGAAGGAAGACTGC TGG Intergenic
No off target data available for this crispr