ID: 1164159757

View in Genome Browser
Species Human (GRCh38)
Location 19:22618482-22618504
Sequence TCTCTCTCCTCTCTGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164159757_1164159764 12 Left 1164159757 19:22618482-22618504 CCAGTCACCAGAGAGGAGAGAGA No data
Right 1164159764 19:22618517-22618539 GGTCCTGGAGTCCGAGTGTCTGG No data
1164159757_1164159762 -9 Left 1164159757 19:22618482-22618504 CCAGTCACCAGAGAGGAGAGAGA No data
Right 1164159762 19:22618496-22618518 GGAGAGAGAAAGCGGAAATGGGG No data
1164159757_1164159761 -10 Left 1164159757 19:22618482-22618504 CCAGTCACCAGAGAGGAGAGAGA No data
Right 1164159761 19:22618495-22618517 AGGAGAGAGAAAGCGGAAATGGG No data
1164159757_1164159765 13 Left 1164159757 19:22618482-22618504 CCAGTCACCAGAGAGGAGAGAGA No data
Right 1164159765 19:22618518-22618540 GTCCTGGAGTCCGAGTGTCTGGG No data
1164159757_1164159763 -3 Left 1164159757 19:22618482-22618504 CCAGTCACCAGAGAGGAGAGAGA No data
Right 1164159763 19:22618502-22618524 AGAAAGCGGAAATGGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164159757 Original CRISPR TCTCTCTCCTCTCTGGTGAC TGG (reversed) Intergenic