ID: 1164159759

View in Genome Browser
Species Human (GRCh38)
Location 19:22618489-22618511
Sequence TCCGCTTTCTCTCTCCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164159759_1164159768 27 Left 1164159759 19:22618489-22618511 CCAGAGAGGAGAGAGAAAGCGGA No data
Right 1164159768 19:22618539-22618561 GGTTCATGTTGCCTGCATTTTGG No data
1164159759_1164159765 6 Left 1164159759 19:22618489-22618511 CCAGAGAGGAGAGAGAAAGCGGA No data
Right 1164159765 19:22618518-22618540 GTCCTGGAGTCCGAGTGTCTGGG No data
1164159759_1164159763 -10 Left 1164159759 19:22618489-22618511 CCAGAGAGGAGAGAGAAAGCGGA No data
Right 1164159763 19:22618502-22618524 AGAAAGCGGAAATGGGGTCCTGG No data
1164159759_1164159764 5 Left 1164159759 19:22618489-22618511 CCAGAGAGGAGAGAGAAAGCGGA No data
Right 1164159764 19:22618517-22618539 GGTCCTGGAGTCCGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164159759 Original CRISPR TCCGCTTTCTCTCTCCTCTC TGG (reversed) Intergenic