ID: 1164159764 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:22618517-22618539 |
Sequence | GGTCCTGGAGTCCGAGTGTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164159757_1164159764 | 12 | Left | 1164159757 | 19:22618482-22618504 | CCAGTCACCAGAGAGGAGAGAGA | No data | ||
Right | 1164159764 | 19:22618517-22618539 | GGTCCTGGAGTCCGAGTGTCTGG | No data | ||||
1164159759_1164159764 | 5 | Left | 1164159759 | 19:22618489-22618511 | CCAGAGAGGAGAGAGAAAGCGGA | No data | ||
Right | 1164159764 | 19:22618517-22618539 | GGTCCTGGAGTCCGAGTGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164159764 | Original CRISPR | GGTCCTGGAGTCCGAGTGTC TGG | Intergenic | ||