ID: 1164159764

View in Genome Browser
Species Human (GRCh38)
Location 19:22618517-22618539
Sequence GGTCCTGGAGTCCGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164159757_1164159764 12 Left 1164159757 19:22618482-22618504 CCAGTCACCAGAGAGGAGAGAGA No data
Right 1164159764 19:22618517-22618539 GGTCCTGGAGTCCGAGTGTCTGG No data
1164159759_1164159764 5 Left 1164159759 19:22618489-22618511 CCAGAGAGGAGAGAGAAAGCGGA No data
Right 1164159764 19:22618517-22618539 GGTCCTGGAGTCCGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164159764 Original CRISPR GGTCCTGGAGTCCGAGTGTC TGG Intergenic