ID: 1164167496

View in Genome Browser
Species Human (GRCh38)
Location 19:22694985-22695007
Sequence CTAAAATTAGCCAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164167496_1164167501 12 Left 1164167496 19:22694985-22695007 CCACCTTCCCTGGCTAATTTTAG No data
Right 1164167501 19:22695020-22695042 GAGACGAGGTTTCGCCGTTTTGG No data
1164167496_1164167500 -2 Left 1164167496 19:22694985-22695007 CCACCTTCCCTGGCTAATTTTAG No data
Right 1164167500 19:22695006-22695028 AGTATTTTTTAGTAGAGACGAGG 0: 16
1: 4108
2: 9525
3: 14134
4: 30387
1164167496_1164167503 21 Left 1164167496 19:22694985-22695007 CCACCTTCCCTGGCTAATTTTAG No data
Right 1164167503 19:22695029-22695051 TTTCGCCGTTTTGGCCAGGCTGG No data
1164167496_1164167502 17 Left 1164167496 19:22694985-22695007 CCACCTTCCCTGGCTAATTTTAG No data
Right 1164167502 19:22695025-22695047 GAGGTTTCGCCGTTTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164167496 Original CRISPR CTAAAATTAGCCAGGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr