ID: 1164167685

View in Genome Browser
Species Human (GRCh38)
Location 19:22696998-22697020
Sequence GGCTAGATACTTAGTGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164167685_1164167689 16 Left 1164167685 19:22696998-22697020 CCAGATTCACTAAGTATCTAGCC No data
Right 1164167689 19:22697037-22697059 AATTAAGTCAAGATCCTAACAGG No data
1164167685_1164167690 25 Left 1164167685 19:22696998-22697020 CCAGATTCACTAAGTATCTAGCC No data
Right 1164167690 19:22697046-22697068 AAGATCCTAACAGGTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164167685 Original CRISPR GGCTAGATACTTAGTGAATC TGG (reversed) Intergenic