ID: 1164167685 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:22696998-22697020 |
| Sequence | GGCTAGATACTTAGTGAATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164167685_1164167689 | 16 | Left | 1164167685 | 19:22696998-22697020 | CCAGATTCACTAAGTATCTAGCC | No data | ||
| Right | 1164167689 | 19:22697037-22697059 | AATTAAGTCAAGATCCTAACAGG | No data | ||||
| 1164167685_1164167690 | 25 | Left | 1164167685 | 19:22696998-22697020 | CCAGATTCACTAAGTATCTAGCC | No data | ||
| Right | 1164167690 | 19:22697046-22697068 | AAGATCCTAACAGGTGCGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164167685 | Original CRISPR | GGCTAGATACTTAGTGAATC TGG (reversed) | Intergenic | ||