ID: 1164170242

View in Genome Browser
Species Human (GRCh38)
Location 19:22718599-22718621
Sequence AGCCCTGGTCCAGCACCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164170242_1164170246 15 Left 1164170242 19:22718599-22718621 CCCGTGGGTGCTGGACCAGGGCT No data
Right 1164170246 19:22718637-22718659 TAAAAATCACACCTGCAAGAAGG No data
1164170242_1164170247 23 Left 1164170242 19:22718599-22718621 CCCGTGGGTGCTGGACCAGGGCT No data
Right 1164170247 19:22718645-22718667 ACACCTGCAAGAAGGTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164170242 Original CRISPR AGCCCTGGTCCAGCACCCAC GGG (reversed) Intergenic
No off target data available for this crispr