ID: 1164170376

View in Genome Browser
Species Human (GRCh38)
Location 19:22719815-22719837
Sequence AACAATGCCCAATATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164170370_1164170376 30 Left 1164170370 19:22719762-22719784 CCCAAGCAGACGAGAACAATAAC No data
Right 1164170376 19:22719815-22719837 AACAATGCCCAATATGAGCAGGG No data
1164170371_1164170376 29 Left 1164170371 19:22719763-22719785 CCAAGCAGACGAGAACAATAACA No data
Right 1164170376 19:22719815-22719837 AACAATGCCCAATATGAGCAGGG No data
1164170373_1164170376 -10 Left 1164170373 19:22719802-22719824 CCCAGCAATATGTAACAATGCCC No data
Right 1164170376 19:22719815-22719837 AACAATGCCCAATATGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164170376 Original CRISPR AACAATGCCCAATATGAGCA GGG Intergenic
No off target data available for this crispr