ID: 1164179629

View in Genome Browser
Species Human (GRCh38)
Location 19:22807445-22807467
Sequence GGGCGGCCCTGCAGGCGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179629_1164179631 -7 Left 1164179629 19:22807445-22807467 CCGCGTCGCCTGCAGGGCCGCCC No data
Right 1164179631 19:22807461-22807483 GCCGCCCCTCCTCCGCCCGCTGG No data
1164179629_1164179644 28 Left 1164179629 19:22807445-22807467 CCGCGTCGCCTGCAGGGCCGCCC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179629 Original CRISPR GGGCGGCCCTGCAGGCGACG CGG (reversed) Intergenic