ID: 1164179630

View in Genome Browser
Species Human (GRCh38)
Location 19:22807453-22807475
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179630_1164179644 20 Left 1164179630 19:22807453-22807475 CCTGCAGGGCCGCCCCTCCTCCG No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179630_1164179646 28 Left 1164179630 19:22807453-22807475 CCTGCAGGGCCGCCCCTCCTCCG No data
Right 1164179646 19:22807504-22807526 TCCAGCCCCGCGCGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179630 Original CRISPR CGGAGGAGGGGCGGCCCTGC AGG (reversed) Intergenic