ID: 1164179632

View in Genome Browser
Species Human (GRCh38)
Location 19:22807462-22807484
Sequence ACCAGCGGGCGGAGGAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179632_1164179649 24 Left 1164179632 19:22807462-22807484 CCGCCCCTCCTCCGCCCGCTGGT No data
Right 1164179649 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
1164179632_1164179644 11 Left 1164179632 19:22807462-22807484 CCGCCCCTCCTCCGCCCGCTGGT No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179632_1164179646 19 Left 1164179632 19:22807462-22807484 CCGCCCCTCCTCCGCCCGCTGGT No data
Right 1164179646 19:22807504-22807526 TCCAGCCCCGCGCGGCTCTGTGG No data
1164179632_1164179651 25 Left 1164179632 19:22807462-22807484 CCGCCCCTCCTCCGCCCGCTGGT No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179632 Original CRISPR ACCAGCGGGCGGAGGAGGGG CGG (reversed) Intergenic