ID: 1164179633

View in Genome Browser
Species Human (GRCh38)
Location 19:22807465-22807487
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179633_1164179649 21 Left 1164179633 19:22807465-22807487 CCCCTCCTCCGCCCGCTGGTTCC No data
Right 1164179649 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
1164179633_1164179651 22 Left 1164179633 19:22807465-22807487 CCCCTCCTCCGCCCGCTGGTTCC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179633_1164179646 16 Left 1164179633 19:22807465-22807487 CCCCTCCTCCGCCCGCTGGTTCC No data
Right 1164179646 19:22807504-22807526 TCCAGCCCCGCGCGGCTCTGTGG No data
1164179633_1164179653 30 Left 1164179633 19:22807465-22807487 CCCCTCCTCCGCCCGCTGGTTCC No data
Right 1164179653 19:22807518-22807540 GCTCTGTGGCCCGGGCTCCAAGG No data
1164179633_1164179644 8 Left 1164179633 19:22807465-22807487 CCCCTCCTCCGCCCGCTGGTTCC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179633 Original CRISPR GGAACCAGCGGGCGGAGGAG GGG (reversed) Intergenic