ID: 1164179634

View in Genome Browser
Species Human (GRCh38)
Location 19:22807466-22807488
Sequence AGGAACCAGCGGGCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179634_1164179646 15 Left 1164179634 19:22807466-22807488 CCCTCCTCCGCCCGCTGGTTCCT No data
Right 1164179646 19:22807504-22807526 TCCAGCCCCGCGCGGCTCTGTGG No data
1164179634_1164179644 7 Left 1164179634 19:22807466-22807488 CCCTCCTCCGCCCGCTGGTTCCT No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179634_1164179649 20 Left 1164179634 19:22807466-22807488 CCCTCCTCCGCCCGCTGGTTCCT No data
Right 1164179649 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
1164179634_1164179651 21 Left 1164179634 19:22807466-22807488 CCCTCCTCCGCCCGCTGGTTCCT No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179634_1164179653 29 Left 1164179634 19:22807466-22807488 CCCTCCTCCGCCCGCTGGTTCCT No data
Right 1164179653 19:22807518-22807540 GCTCTGTGGCCCGGGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179634 Original CRISPR AGGAACCAGCGGGCGGAGGA GGG (reversed) Intergenic