ID: 1164179637

View in Genome Browser
Species Human (GRCh38)
Location 19:22807473-22807495
Sequence AGTGGGGAGGAACCAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179637_1164179655 26 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179655 19:22807522-22807544 TGTGGCCCGGGCTCCAAGGCGGG No data
1164179637_1164179654 25 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179654 19:22807521-22807543 CTGTGGCCCGGGCTCCAAGGCGG No data
1164179637_1164179644 0 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179637_1164179656 27 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179656 19:22807523-22807545 GTGGCCCGGGCTCCAAGGCGGGG No data
1164179637_1164179651 14 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179637_1164179649 13 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179649 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
1164179637_1164179653 22 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179653 19:22807518-22807540 GCTCTGTGGCCCGGGCTCCAAGG No data
1164179637_1164179646 8 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179646 19:22807504-22807526 TCCAGCCCCGCGCGGCTCTGTGG No data
1164179637_1164179657 28 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179637 Original CRISPR AGTGGGGAGGAACCAGCGGG CGG (reversed) Intergenic